Question: You will be expected to complete one guest registration. Your guest has called to make a reservation for two night stay for his wedding anniversary.

You will be expected to complete one guest registration. Your guest has called to make a reservation for two night stay for his wedding anniversary. He has asked for meals to be provided. He has made a special request for the day of arrival. Write out a script that you would use for taking a reservation for the guest.

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related General Management Questions!

Planning is one of the most important management functions in any business. A front office managers first step in planning should involve determine the departments goals. Planning also includes...

Hi there , I need help. for my work i need a relevant and well written introduction as well as conclusion to the following below. My work is complete i just need a introduction and conclusion please...

Job descriptions: In determining who will be responsible for what duties, you are to compile a Job description for the Assistant Front Office Manager, The Front Desk Agent, The Reservations Agent and...

Unit 8 Integration Case Information Northern Escape Resorts (NER) is a private corporation that owns three luxury boutique hotels that are located in Niagara-on-the-Lake, Toronto, and Ottawa. The...

Northern Escape Resorts (NER) is a private corporation that owns three luxury boutique hotels that are located in Niagara-on-the-Lake, Toronto, and Ottawa. The largest hotel, The Skyline Inn and Spa,...

Create an E-R diagram Database Development Project Case The following case will be used for the project. Bear in mind that it will be used for data modeling normalization, database design, and...

can you solve this question please with proper reason Unit 8 Integration Case Information Northern Escape Resorts (NER) is a private corporation that owns three luxury boutique hotels that are...

Please read the case and answer the following questions for this case: Briefly analyze each of the business models for the industry analysis (Porter's 5 Forces, the 4'p of marketing, the PLC model,...

What is infinite loading? What is finite loading?

Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it...

Definition ( or partial definition ) Terma . Charged with maintaining detailed records of shareholders and handling purchases and sales of stock.b . An unsecured bond, dependent upon the general...

What is an example of constructive feedback? provide reference