Your research group has collected three different isolates of Vibrio cholerae from three different individuals/patients with...

  

Transcribed Image Text:

Your research group has collected three different isolates of Vibrio cholerae from three different individuals/patients with an active cholera infection. You sequenced the genomes of all three isolates in an effort to identify what genes they encode. Use the information below to identify specific genetic motifs, as well as transcribe and translate a sequence from Isolate #1 into an mRNA transcript and amino acid polypeptide. In an effort to identify genetic promoter motifs in your new isolates, you used bioinformatic software to map the promoter regions from a previously sequenced V. cholerae strain. Below are six sequences from six different promoter regions from that previously sequenced genome. You aligned these sequences (knowing their -35/-10/+1, and Shine-Dalgarno/Ribosomal Binding Site, highlighted below) to create consensus sequences to search your new genome sequences for these genetic motifs. -10 genel GTGAGTGATTGACAAGDCTAGCTAGGTCGACTATAATCGACTAGCATTTATGGAATGACGAGGTGA gene2 CGACTACGATGACAGAGCTACGACTAGCATATATATAGACTACGATCGGATCGATCAAGGTGGTAG gene3 TAGCATAGGTGACTAGCATGGGCATCAGCATTTAAATGCATCAGTTTATAGCCCATCAGGAGGGCG gene4 GCATGGGATTCAGATACGACTGGGGACTGACAATAATCGACTACGACTGACTAGCATAGGTGGAYC gene5 ACGGGAGATTGTCATCAGAAAAATCAGCATGTATTATCACTGACTACGAGCATACGGTGGAGGTTT gene6 GATGATAGTTGACAATTAATCATCGAACTAGTATAATGATGATAGATACGACTAACGAGCAGGAAA -35 Based on the above sequence alignments, what are the consensus sequences for the following genetic motifs? Motif Consensus Sequence -35 site -10 site TATAAT TATAAT Shine-Dalgarno (RBS) S.D. AGGAGG Using the sequence below (Coding strand), highlight/circle/box the -35-site, -10-site, and the Shine-Dalgarno Sequence. The +1 (A) is already highlighted. 5-GGGCATCGATTGACAAGCTAGCGGATCAGCGTATAATGGGAGCAGCTGCTAGCAATAAAAATTTTGAGGAGGETT TTAAAAGAATGAAAGGGCGGCTGCATCATTCTCGTGTTATTACCTAAGGGGGGCCCCTTTTTTTTTTTTTTGATCGA-3' MB 351 Concept Check 3 Below is the coding strand sequence of your potential gene from your newly sequenced genome (it is the same sequence from the previous page). 5'-GGGCATCGATTGACAAGCTAGCGGATCAGCGTATAATGGGAGCAGCTGCTAGCAATAAAAATTTTGAGGAGGETT TTAAAAGAATGAAAGGGCGGCTGCATCATTCTCGTGTTATTACCTAAGGGGGGCCCCTT TTTTTTTTGATCGA-3' You previously identified promoter motifs of your potential gene. Now that you know the promoter architecture, transcribe this sequence into an mRNA transcript, AND then translate it into an amino acid polypeptide. *Remember to use all of the genetic motifs you identified earlier to complete this task. mRNA Transcript Sequence: (*Highlight or underline the Shine-Dalgarno Sequence/Ribosomal Binding Site) AAAAAUUUUGAGGAGGCUUUUAAAAGAAUGAAAGGGCGGCUGCAUCAUUCUCGUGUUAUUACCUAAGG GGGGCCCCUUUUUUUUUUUGACGAUCGA Translated Amino Acid Sequence: (*A codon chart is included on the last page of this document) Lys-Gly-Arg-Leu-His-His-Ser-Arg-Val-Ile-Ibr. Questions: Based on the transcribed mRNA sequence, would you hypothesize that this gene uses a Rho-Independent or Rho- Dependent transcriptional termination mechanism? Why do you think this? Are the -35 and -10 sites always 35/10 bases from the +1 site? If I did not highlight the +1 site, would you have been able to identify the +1 site using the information provided? Your research group has collected three different isolates of Vibrio cholerae from three different individuals/patients with an active cholera infection. You sequenced the genomes of all three isolates in an effort to identify what genes they encode. Use the information below to identify specific genetic motifs, as well as transcribe and translate a sequence from Isolate #1 into an mRNA transcript and amino acid polypeptide. In an effort to identify genetic promoter motifs in your new isolates, you used bioinformatic software to map the promoter regions from a previously sequenced V. cholerae strain. Below are six sequences from six different promoter regions from that previously sequenced genome. You aligned these sequences (knowing their -35/-10/+1, and Shine-Dalgarno/Ribosomal Binding Site, highlighted below) to create consensus sequences to search your new genome sequences for these genetic motifs. -10 genel GTGAGTGATTGACAAGDCTAGCTAGGTCGACTATAATCGACTAGCATTTATGGAATGACGAGGTGA gene2 CGACTACGATGACAGAGCTACGACTAGCATATATATAGACTACGATCGGATCGATCAAGGTGGTAG gene3 TAGCATAGGTGACTAGCATGGGCATCAGCATTTAAATGCATCAGTTTATAGCCCATCAGGAGGGCG gene4 GCATGGGATTCAGATACGACTGGGGACTGACAATAATCGACTACGACTGACTAGCATAGGTGGAYC gene5 ACGGGAGATTGTCATCAGAAAAATCAGCATGTATTATCACTGACTACGAGCATACGGTGGAGGTTT gene6 GATGATAGTTGACAATTAATCATCGAACTAGTATAATGATGATAGATACGACTAACGAGCAGGAAA -35 Based on the above sequence alignments, what are the consensus sequences for the following genetic motifs? Motif Consensus Sequence -35 site -10 site TATAAT TATAAT Shine-Dalgarno (RBS) S.D. AGGAGG Using the sequence below (Coding strand), highlight/circle/box the -35-site, -10-site, and the Shine-Dalgarno Sequence. The +1 (A) is already highlighted. 5-GGGCATCGATTGACAAGCTAGCGGATCAGCGTATAATGGGAGCAGCTGCTAGCAATAAAAATTTTGAGGAGGETT TTAAAAGAATGAAAGGGCGGCTGCATCATTCTCGTGTTATTACCTAAGGGGGGCCCCTTTTTTTTTTTTTTGATCGA-3' MB 351 Concept Check 3 Below is the coding strand sequence of your potential gene from your newly sequenced genome (it is the same sequence from the previous page). 5'-GGGCATCGATTGACAAGCTAGCGGATCAGCGTATAATGGGAGCAGCTGCTAGCAATAAAAATTTTGAGGAGGETT TTAAAAGAATGAAAGGGCGGCTGCATCATTCTCGTGTTATTACCTAAGGGGGGCCCCTT TTTTTTTTGATCGA-3' You previously identified promoter motifs of your potential gene. Now that you know the promoter architecture, transcribe this sequence into an mRNA transcript, AND then translate it into an amino acid polypeptide. *Remember to use all of the genetic motifs you identified earlier to complete this task. mRNA Transcript Sequence: (*Highlight or underline the Shine-Dalgarno Sequence/Ribosomal Binding Site) AAAAAUUUUGAGGAGGCUUUUAAAAGAAUGAAAGGGCGGCUGCAUCAUUCUCGUGUUAUUACCUAAGG GGGGCCCCUUUUUUUUUUUGACGAUCGA Translated Amino Acid Sequence: (*A codon chart is included on the last page of this document) Lys-Gly-Arg-Leu-His-His-Ser-Arg-Val-Ile-Ibr. Questions: Based on the transcribed mRNA sequence, would you hypothesize that this gene uses a Rho-Independent or Rho- Dependent transcriptional termination mechanism? Why do you think this? Are the -35 and -10 sites always 35/10 bases from the +1 site? If I did not highlight the +1 site, would you have been able to identify the +1 site using the information provided?

Answer rating: 100% (QA)

Consensus sequences for the following genetic motifs Motif Consensus Sequence 35 site TATAAT 10 site TATAAT ShineDalgarno RBS AGGAGG Highlighted 35sit... View the full answer