What is the current taken by the display connected in Fig. 3.12, when the digit 3 is
Question:
What is the current taken by the display connected in Fig. 3.12, when the digit 3 is showing?
Transcribed Image Text:
to 7-segment display pins 3,8 pin 7, seg. a pin 6, seg. b pin 4, seg. c pin 2, seg. d < pin 1, seg. e pin 9, seg. f < pin 10, seg. g pin 5, seg, dp Gnd Vin Vb nR 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Figure 3.12 mbed Microcontroller Vout Vu IF- IF+ RD- RD+ TD- TD+ D- D+ 30 29 28 27 26 25 24 23 22 21
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (1 review)
Answered By
Shameen Tahir
The following are details of my Areas of Effectiveness. The following are details of my Areas of Effectiveness English Language Proficiency, Organization Behavior , consumer Behavior and Marketing, Communication, Applied Statistics, Research Methods , Cognitive & Affective Processes, Cognitive & Affective Processes, Data Analysis in Research, Human Resources Management ,Research Project,
Social Psychology, Personality Psychology, Introduction to Applied Areas of Psychology,
Behavioral Neurosdence , Historical and Contemporary Issues in Psychology, Measurement in Psychology, experimental Psychology,
Business Ethics Business Ethics An introduction to business studies Organization & Management Legal Environment of Business Information Systems in Organizations Operations Management Global Business Policies Industrial Organization Business Strategy Information Management and Technology Company Structure and Organizational Management Accounting & Auditing Financial Accounting Managerial Accounting Accounting for strategy implementation Financial accounting Introduction to bookkeeping and accounting Marketing Marketing Management Professional Development Strategies Business Communications Business planning Commerce & Technology Human resource management General Management Conflict management Leadership Organizational Leadership Supply Chain Management Law Corporate Strategy Creative Writing Analytical Reading & Writing Other Expertise Risk Management Entrepreneurship Management science Organizational behavior Project management Financial Analysis, Research & Companies Valuation And any kind of Excel Queries.
4.70+
16+ Reviews
34+ Question Solved
Related Book For
Fast And Effective Embedded Systems Design Applying The ARM Mbed
ISBN: 978-0081008805
2nd Edition
Authors: Tim Wilmshurst, Rob Toulson
Question Posted:
Students also viewed these Computer science questions
-
Let A, B be sets. Define: (a) the Cartesian product (A B) (b) the set of relations R between A and B (c) the identity relation A on the set A [3 marks] Suppose S, T are relations between A and B, and...
-
answer the question clearly You are building a flight-control system for which a convincing safety case must be made. Would you assign the tasks of safety requirements engineering, test case...
-
The windings of an electromagnet have inductance L = 8.0 H and resistance R = 2.0 . A 100.0-V dc power supply is connected to the windings by closing switch S2. (a) What is the current in the...
-
Name: 9. 11. Bell: Directions: Evaluate each expression using the order of operations. 1. 17-5-4+2 2. 40-32+8+5--2 Date: 5. 2018-(5+3)+7] 3.35-14+2+8 7.1+(-2-5)+(14-17)-4 25 +8+3 4+3 Unit 1: Algebra...
-
A jet of velocity V strikes a vane which moves to the right at speed Vc, as in Fig. P11.18. The vane has a turning angle θ. Derive an expression for the power delivered to the vane by the jet....
-
Data for Munsun Company are presented in P12.3A. Instructions Prepare the operating activities section of the statement of cash flows using the direct method. Data From P12.3A The income statement of...
-
If you eat a pound of pasta, will you gain a pound of weight? Why not?
-
Frazer Corporation purchased 60 percent of Minnow Corporation's voting common stock on January 1, 20X1. On January 1, 20X5, Frazer received $245,000 from Minnow for a truck Frazer had purchased on...
-
This involves one person (or a small team) and can be completed in less than a day. One example is to use torque wrenches instead of adjustable wrenches. This statement BEST describes which of the...
-
If in Fig. 3.12 a segment current of approximately 4 mA was required, what value of resistor would need to be introduced in series with each segment? to 7-segment display pins 3,8 pin 7, seg. a pin...
-
The circuit of Fig. 3.5B is used 8 times over to connect 8 switches to 8 mbed digital input. The pull-up resistors have a value of 10 k and are connected to the mbed supply of 3.3 V. What current is...
-
Assume that you want to retire early at age 52. You plan to save using one of the following two strategies: (1) save $2,700 a year in an IRA beginning when you are 27 and ending when you are 52 (25...
-
You get a large bonus at the end of the year that you dont plan on spending anytime soon. Should you put your money in stocks, in bonds, or in the bank as savings? What factors inform your decision?...
-
Are you willing to embrace your prejudices (your personal peculiarities and socially conditioned ways of knowing) so you can do something about them?
-
How can the perspective of change be understood through folktales?
-
How can public and/or private sector leadership align and work together on concerted action to be resilient after Covid-19, and what role does AI, robotics, and big data insights play?
-
Think of extending competitive advantages to long-term viability. What forces drive businesses toward search of long-term viability? What are major counterforces that tend to dwarf efforts of...
-
For each situation listed, indicate by letter the appropriate qualitative characteristic(s) or accounting concept(s) applied. A letter may be used more than once, and more than one characteristic or...
-
The Alert Company is a closely held investment-services group that has been very successful over the past five years, consistently providing most members of the top management group with 50% bonuses....
-
Every time I think Ive captured user information requirements, theyve already changed. Its like trying to hit a moving target. Half the time, I dont think they even know what they want themselves,...
-
Harold, a district manager for the multioutlet chain of Sprockets Gifts, thinks that building a prototype can mean only one thing: a nonworking scale model. He also believes that this way is too...
-
Ive got the idea of the century! proclaims Bea Kwicke, a new systems analyst with your systems group. Lets skip all this SDLC garbage and just prototype everything. Our projects will go a lot more...
-
What were the key objectives that Basel Committee for banking Supervision was designed to address?How did they go about achieving such objectives? b. What key problems were identified with Basel II?...
-
Newport, Incorporated, used Excel to run a least-squares regression analysis, which resulted in the following output Regression Statistics Multiple R R Square Observations 0.7225 0.8500 30 5...
-
A particular DNA segment is sequenced in five random people drawn from the population. The results are shown in the table below: ACAAGTTTAGCACACACACATT Individual 1 Copy 1 Copy 2 ACAAGTTTAGCACACACATT...
Study smarter with the SolutionInn App