Question: Broken DNA can be repaired by DNA ligase (single-strand breaks) or nonhomologous end-joining (double-strand breaks). Explain why the cell's set of repair enzymes also includes

Broken DNA can be repaired by DNA ligase (single-strand breaks) or nonhomologous end-joining (double-strand breaks). Explain why the cell's set of repair enzymes also includes tyrosyl-DNA phosphodiesterases.

Step by Step Solution

★★★★★

3.43 Rating (156 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

Topoisomerases maintain the appropriate degree of supercoiling during DNA replication These ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

930-M-S-B-C (1749).docx

120 KBs Word File

Students Have Also Explored These Related Biochemistry Questions!

With regard to the repair of double-strand breaks, what are the advantages and disadvantages of homologous recombination repair versus non-homologous end joining?

Indicate whether each of the following statements about the structure of DNA is true or false. (Each letter is used to refer to the concentration of that base in DNA.) (a) A + T = G + C (b) A = G; C...

Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA? Describe some general features of...

Match each of the following aspects of DNA with the main structural feature which makes it possible. You may use each match more than once ( or not at all ) . 2 V DNA can be repaired. Proteins can...

AA factory manager must decide whether to stock a particular spare part. The part is absolutely essential to the operation of certain machines in the plant. Stocking the part costs $10 per day in...

Match each of the following aspects of DNA with the main structural feature which makes it possible. You may use each match more than once ( or not at all ) . DNA can be repaired. Proteins can "read"...

Part 1 : one extended scenario with variations CRISPR Cas 9 was targeted to a particular sequence, \ ( 5 ^ { \ prime } \ ) - TAACCAGTGTTCCAAGGTGA - 3 ' ( PAM sequence shown in bold ) . 1 . During...

Consider a machine that can be in one of three states: good condition, fair condition, or broken down. Suppose that a machine in good condition will remain this way for a mean time 1 and then will go...

Jonfran Company manufactures three different models of paper shredders including the waste container, which serves as the base. While the shredder heads are different for all three models, the waste...

Armstrong Company manufactures three models of paper shredders, including the waste container, which serves as the base. Whereas the shredder heads are different for all three models, the waste...

Lickety Split sells ice cream cones in a variety of flavors. Data for a recent week appear here: The manager estimates that if she were to increase the price of cones from $1.75 to $1.93 each, weekly...

A boundary layer separates from a wall to form a free shear layer. Assuming that the shear layer has a thickness of 10 mm, that the flow velocity above the layer is U 11. m/s and that the velocity...

13. On January 2, 20X1, Valentinas Beauty Supplies Inc. issued Check 3100 for $400 to establish a petty cash fund. On January 31, Check 3159 was issued to replenish the petty cash fund. An analysis...

Create a simulation of flipping 100 pennies. a. Show the probability distribution (histogram) for the number of heads and the number of tails. b. Describe the appearance of the distribution. c. What...

Mathematical Calculate the hydroxide ion concentration, [OH], for each of the materials used in Question 24.

Define the following: (a) Acid dissociation constant (b) Acid strength (c) Amphipathic (d) Buffering capacity (e) Equivalence point (f) Hydrophilic (g) Hydrophobic (h) Nonpolar (i) Polar (j) Titration

Look at Figure 2.17 and Table 2.8. Which compound in the table would give a titration curve the most similar to the one shown in the figure? Why?

If Z a/2 = 2.25400, determine the proportion of (1-a) 100% confidence intervals that will not capture u when the confidence intervals are computed as m+/- A a/2 (O m )?

What has to happen for a stock that pays a 1% quarterly dividend during the past 4 quarters to experience a negative total return over the same year

The Anson Jackson Court Company (AJC) currently has $200,000 market value (and book value) of perpetual debt outstanding carrying a coupon rate of 6%. Its earnings before interest and taxes (EBIT)...