Describe how nucleotide substitutions at different positions in codons affect the characteristics of the encoded amino acids?
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 63% (11 reviews)
a Changes in the third position of a codon infrequently ch...View the full answer
Answered By
Gauri Hendre
I worked as EI educator for Eduphy India YT channel. I gave online tutorials to the students who were living in the villages and wanted to study much more and were preparing for NEET, TET. I gave tutions for topics in Biotechnology. I am currently working as a tutor on course hero for the biochemistry, microbiology, biology, cell biology, genetics subjects. I worked as a project intern in BAIF where did analysis on diseases mainly genetic disorders in the bovine. I worked as a trainee in serum institute of India and Vasantdada sugar institute. I am working as a writer on Quora partner program from 2019. I writing on the topics on social health issues including current COVID-19 pandemic, different concepts in science discipline. I learned foreign languages such as german and french upto A1 level. I attended different conferences in the science discipline and did trainings in cognitive skills and personality development skills from Lila Poonawalla foundation. I have been the member of Lila poonawalla foundation since 2017. Even I acquired the skills like Excel spreadsheet, MS Office, MS Powerpoint and Data entry.
5.00+
4+ Reviews
10+ Question Solved
Related Book For
Fundamentals of biochemistry Life at the Molecular Level
ISBN: 978-0470547847
4th edition
Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt
Question Posted:
Students also viewed these Medical Sciences questions
-
The following apparatus can be used to measure atomic and molecular speed. Suppose that a beam of metal atoms is directed at a rotating cylinder in a vacuum. A small opening in the cylinder allows...
-
A homologous DNA region, which was 20,000 bp in length, was sequenced among four different species. The following number of nucleotide differences were obtained: Construct a phylogenetic tree that...
-
Let's suppose a DNA mutation changes the consensus sequence at the -35 location in a way that inhibits factor binding. Explain how a mutation could inhibit the binding of factor to the DNA. Look at...
-
A thermocouple Type K is calibrated in lab condition at 50% relative humidity (RH) prior to outdoor operation. After 12-month in outdoor installation, the thermocouple is again tested at 75% RH. Both...
-
Florences daughter, Eunice, needs $5,000 to start a business. Florence agrees to give her the money but will have to sell some securities to raise that much cash. Florence has 1,200 shares of Tom...
-
Suppose organisms grow in mass according to the differential equation dM /dt = t n where M is measured in grams and t is measured in days. For each of the following values for n and , find a. The...
-
Discuss the purpose and various titles of the Patient Protection and Affordable Care Act of 2010 (PPACA).
-
Explain how the conversion feature of convertible debt has a value (a) To the issuer and (b) To the purchaser.
-
Adger Corporation is a service company that measures its output based on the number of customers served. The company provided the following fixed and variable cost estimates that it uses for...
-
"Why do you say we would prefer our leases to be classified as operating leases?" says your colleague in the accounting department. "I thought that with the new lease accounting rules, both operating...
-
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
-
What two reactions are carried out by aminoacyl-tRNA synthetases?
-
What does the loan loss coverage ratio measure?
-
Harley Ltd., a manufacturer of motorcycles located in Burnaby, B.C., successfully negotiated a contract to sell 100 small motorcycles to the police department of Fairbanks, Alaska. The contract price...
-
Restructuring the mudaraba contract: Hussain enters into a mudaraba agreement with Hasan, who will be the mudharib. The terms of the agreement are as follows: a. Hasan gets $4,000 monthly salary,...
-
Othman al Habshi needs $50,000 for his sons wedding. He decided to seek Islamic financing using tawarruq financing from Bank Islam of Yemen with a term of 10 years. If the bank uses a 7% compound...
-
How can social publishing, along with SEO and SMO, help to meet marketing objectives?
-
What types of companies does Section 1751 of the CICA Handbook apply to for interim reporting?
-
The number of calls received per day at a crisis hot line is distributed as follows: Find the mean, variance, and standard deviation of the distribution. Number X 30 Probability P(X) 0.05 0.21 33 34...
-
7 A 29-year-old, previously healthy man suddenly collapses at a party where legal and illicit drugs are being used. Enroute to the hospital, he requires resuscitation with defibrillation to establish...
-
In what naturally occurring nucleic acids would you expect to find A-form helices, B-form helices, Z-form helices, nucleosomes, and circular DNA?
-
What are the two principal opposing views regarding the patenting of genes?
-
What two genes are at the heart of a current lawsuit and what is their importance?
-
Assume an organization needs to do mass layoffs in order to counteract the slowing market demand for their product. What would be considered going above and beyond legal duty to do the right thing by...
-
We are in an incredibly stressful time in our lives. Watch the Ted Talk, "How Burnout Makes Us Less Creative". Share your thoughts on the video. Then discuss what are some actions that you can take...
-
Image transcription text QUESTION 1 Diffusion (a) The diffusion coefficients for carbon in nickel are given at two temperatures as shown in Table 1: Table 1 diffusion coefficients for carbon in...
Study smarter with the SolutionInn App