Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was
Question:
Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was transcribed.
Problem 28.24
UAC is a codon for tyrosine it was transcribed from ATG of the template strand of a DNA chain.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 75% (16 reviews)
UAC is a codon for tyrosine it was transcribed ...View the full answer
Answered By
Larlyu mosoti
I am a professional writer willing to do several tasks free from plagiarism, grammatical errors and submit them in time. I love to do academic writing and client satisfaction is my priority. I am skilled in writing formats APA, MLA, Chicago, and Harvard I am a statistics scientist and I can help out in analyzing your data. I am okay with SPSS, EVIEWS, MS excel, and STATA data analyzing tools.
Statistical techniques: I can do linear regression, time series analysis, logistic regression, and some basic statistical calculations like probability distributions. . I'm ready for your working projects!
Services I would offer:
• Academic writing.
• Article writing.
• Data entry.
• PDF conversion.
• Word conversion
• Proofreading.
• Rewriting.
• Data analyzing.
The best reason to hire me:
- Professional and Unique work in writing.
- 100% satisfaction Guaranteed
- within required time Express delivery
- My work is plagiarism Free
- Great communication
My passion is to write vibrantly with dedication. I am loyal and confident to give my support to every client. Because Client satisfaction is much more important to me than the payment amount. A healthy client-contractor relationship benefits in the longer term. Simply inbox me if you want clean work.
5.00+
3+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Draw the complete structure of the following peptide. Ser-Gln-Met NH2
-
Draw the complete structure of the ribonucleotide codon UAC, for what amino acid does this sequence code?
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
Question 4: Partners M, N, and O agreed to share the net income or loss in the ratio of 5:4:3 respectively. Their capital balances were Rs.80, 000, Rs. 70, 000 and Rs. 60, 000. They decided that "O"...
-
What five entry modes do firms consider as paths to use to enter international markets? What is the typical sequence in which firms use these entry modes?
-
Evaluate the net heat transfer between the disks described in Problem 23.33 if they are bases of a cylinder with the side wall considered a nonconducting, re-radiating surface. How much energy will...
-
Consider the National Football League data in Table B.1. Build a linear regression model relating the number of games won to the yards gained rushing by opponents $x_{8}$, the percentage of rushing...
-
David Lemay is the chief executive officer of Brenna Electronics. Lemay is an expert engineer but a novice in accounting. Lemay asks you, as an accounting student, to explain (a) the bases for...
-
A bond with a $1,000 face value and 13 years to maturity is currently selling for $920. If the yield to maturity is 5.6%, what is the coupon rate of the bond?
-
3. Find the regular expression for the language accepted by the following automaton. b
-
What anti codon sequences of tRNAs are coded for by the codons in Problem 28.21? Problem 28.21 For what amino acids do the following ribonucleotide triplets code? (a) AAU (b) GAG (c) UCC (d) CAU
-
Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly- Phe-Met
-
An alloy is made up of 27 % metal A, 34 % metal B, and 39 % metal C. During the past year, prices of the metals have changed as shown in the table. Find the simple aggregative index for the cost of...
-
The chemistry department has 70 students, of whom 20% are women. The physics department has 60 students, of whom 15% are women. What percent of the students in chemistry and physics are women ?
-
A $54,000 machine with a 5-year class life was purchased 2 years ago. The machine will now be sold for $50,000 and replaced with a new machine costing $93,000, with a 10-year class life. The new...
-
A product line can sell 100,000 products per year for 3 years (after which time this project is expected to shut down). The product will sell for $6 each, with variable costs of $1 for each one...
-
A planet in a distant galaxy has an atmosphere with a pressure of 800 mmHg. Oxygen makes up 30% of the atmosphere. What is the partial pressure of oxygen in the atmosphere of this distant planet?
-
Stock investments between 20% and 50% allow the investor to __________. have some control and influence over the company invested in buy another company decide whether to lay off employees sell more...
-
What is a major shortcoming of the equivalent annual benefit method?
-
Match each of the key terms with the definition that best fits it. _______________ A record of the sequence of data entries and the date of those entries. Here are the key terms from the chapter. The...
-
Eighteen kilograms of the refrigerant HFC-134a at 150C is contained in a 0.03-m 3 tank. Compare the prediction you can make for the pressure in the tank with that obtained using Fig. 3.3-4. For data,...
-
Draw the structures of the following RNA components: a. UCC b. CAA c. ACG
-
Using eq. 18.2 as a guide, write an equation for hydrolysis of a. 2-deoxythymidine b. 2-deoxyguanosine
-
Consider the following mRNA sequence: 5' A--G--C--U--C--G--U--A--C 3' Draw the segment of DNA double helix from which this sequence was derived, using the schematic method shown at the right of...
-
1. How does marketing create value, and how do firms become more value driven? 2. Describe a firm's stakeholders and how they are impacted by conscious marketing.
-
Beginning inventory 100 units @ $8.00 = $ 800 Purchase # 1 200 units @ $6.00 = 1,200 Purchase # 2 100 units @ $12.00 = 1,200 Total 400 units $3,200 Ending inventory is 150 units. 1. What is cost of...
-
Sam's Ice Creams, a cottage country favourite in Northern Ontario, has launched a new range of ice creams branded as "Summer Flavours." To capitalize on the cottage and tourism season from May to...
Study smarter with the SolutionInn App