Question: Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was transcribed. Problem 28.24 UAC is a codon for

Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was transcribed.


Problem 28.24

UAC is a codon for tyrosine it was transcribed from ATG of the template strand of a DNA chain.

Step by Step Solution

★★★★★

3.39 Rating (165 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

UAC is a codon for tyrosine it was transcribed ... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Document Format (1 attachment)

Word file Icon

22-C-O-B-M (206).docx

120 KBs Word File

Students Have Also Explored These Related Organic Chemistry Questions!

Q:

Draw the complete structure of the following peptide. Ser-Gln-Met NH2

Q:

Draw the complete structure of the ribonucleotide codon UAC, for what amino acid does this sequence code?

Q:

A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-

Q:

Draw the complete structure of the deoxyribonucleotide sequence from which the codon in Problem 16.35 was transcribed. Problem 16.35 Draw the complete structure of the ribonucleotide codon UAC. For...

Q:

help with b&c please, the rest is backgound info! 4. The following questions are about the experiment shown in Figure 3, where DNA products generated by different primase enzymes are analyzed. a) The...

Q:

4. The following questions are about the experiment shown in Figure 3, where DNA products generated by different primase enzymes are analyzed. a) The authors describe panel A as an "initiation assay"...

Q:

Questions: (a) describe the archetypes at play in this case study (b) explain where the leverage lies in the case at hand (c) identify the problem symptom, the fundamental response and the...

Q:

I am having trouble trying to answer this question the assigned amino acid is Histidine Instructions: Complete the following problems and be sure to show all your work. 1. Draw your group's amino...

Q:

4.1 ANSWER ALL FOR HIGH RATING Draw a complete structure for a molecule with the molecular formula CCl4. - Explicitly draw all H atoms. - In cases where there is more than one answer, just draw one....

Q:

B. For the given oligopeptide sequence, Asn-Cys-Gly-Val-Trp-Cys-Thr-Ala, Draw the complete structure. Also name the possible bondings with another similar oligopeptide. (4 Marks)

Q:

Compare and contrast teams under the following team characteristics. Teams that fear conflict and teams that engage in conflict

Q:

Which alkyne would be the best reagent to use for the synthesis of each of the following ketones? a. b. c. , CH3CH2CCH2CH2CH3

Q:

The CEO of Consumer Products, Inc., sees no reason to hire a specialist in privacy law. He argues that their information security team can easily handle any privacy threats. How would you respond to...

Q:

China and India are the two most populous countries in the world and have also grown very rapidly in recent years. From 1978 to 2004, GDP in China grew at the astounding rate of 9.3 percent per year...

Q:

A company reports the following: Net sales ....... $4,400,000 Average total assets .... 2,000,000 Determine the ratio of net sales to assets.

Q:

Suppose the market for gourmet chocolate is in long-run equilibrium, and an economic downturn has reduced consumer discretionary incomes. Assume chocolate is a normal good, and the chocolate...

Q:

A company reports the following: Income before income tax .....$8,000,000 Interest expense ......... 500,000 Determine the number of times interest charges are earned.

Q:

All-Canadian, Ltd. is a multiproduct company with three divisions: Pacific Division, Plains Division, and Atlantic Division. The company has two sources of long-term capital: debt and equity. The...

Q:

Eighteen kilograms of the refrigerant HFC-134a at 150C is contained in a 0.03-m 3 tank. Compare the prediction you can make for the pressure in the tank with that obtained using Fig. 3.3-4. For data,...

Q:

Draw the structures of the following RNA components: a. UCC b. CAA c. ACG

Q:

Using eq. 18.2 as a guide, write an equation for hydrolysis of a. 2-deoxythymidine b. 2-deoxyguanosine

Q:

Write structural formulas, or build molecular models for all the constitutionally isomeric alcohols of molecular formula C5H12O. Assign a substitutive and a functional class name to each one, and...

Q:

A hydroxyl group is a somewhat "smaller" substituent on a six-membered ring than is a methyl group. That is, the preference of a hydroxyl group for the equatorial orientation is less pronounced than...

Q:

By assuming that the heat of combustion of the cis isomer was larger than the trans, structural assignments were made many years ago for the stereoisomeric 2-, 3-, and 4 methylcyclohexanols. This...

Q:

Which of the following is.NOT a use of Al? Computer Vision Natural language processing (NPL) Recommendation Systems Expert Systems Decision Support Systems