Question: For the conversion of reactant A to product B, the change in enthalpy is 7 kJ mol-1 and the change is entropy is 20

For the conversion of reactant A to product B, the change in enthalpy is 7 kJ ∙ mol-1 and the change is entropy is 20 J ∙ K-1 ∙ mol-1. Above what temperature does the reaction become spontaneous?

Step by Step Solution

★★★★★

3.46 Rating (166 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

In order for G to have a n... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

930-M-S-B-C (920).docx

120 KBs Word File

Students Have Also Explored These Related Biochemistry Questions!

Many biochemical reactions are catalyzed by large protein molecules called enzymes. A typical mechanism for the conversion of a biochemical substrate (S) to product (P) catalyzed by an enzyme (E)...

Give chemical equations for the conversion of carbon in coal to methane, CH4.

An important reaction for the conversion of natural gas to other useful hydrocarbons is the conversion of methane to ethane. 2CH4 (g) C2H6 (g) + H2 (g) In practice, this reaction is carried out in...

For the conversion of reactant A to product B , the change in enthalpy is 6 . 7 6 k J * m o l - 1 and the change in entropy is 4 9 . 6 J * K - 1 * m o l - 1 . Above what temperature, in Kelvin, does...

Can you please help me with these three questions im confused on If Keq=16, and the starting concentrations of Q and R are both 40M, then the equilibrlum concentration of Q is M and the equilibrium...

0.577 g of magnesium metal was weighed into a styrofoam calorimeter. Next, 60 mL of 1.0 M hydrochloric acid, weighing 60.488 g and having an initial temperature (i.e. Ti) of 20.8 C, was added to the...

Can you please look over these questions and make sure I am correct if you do what is asked thumbs up if not then i will thumbs down: Focus 3 - Discussion 3.4, 3.6; Exercises 3A.1 (just a), 3A.3,...

Need help with #4! (2 Points) 2. Calculate the enthalpy change, AH, for each reaction in terms of kJ/mol of each reactant. NH: mis * AT Reaction i OH= mx SxDT= 103 x 4.18 x 13,5= 5812, 29 J/mol =...

PLEASE HELP 1. For the reaction below, r H = 5005.0 kJ mol 1 . What is the standard enthalpy of formation of C 10 H 8 (s)? C 10 H 8 (s) + 12 O 2 (g) 10 CO 2 (g) + 4 H 2 O(l) Give your answer in...

Th e denaturation of a biological macromolecule can be described by the equilibrium macromolecule in native form 7 macromolecule in denatured form: a. Show that the fraction theta of denatured...

The number of U.S. patent applications was 520 thousand in 2010, and it increased by about 21.7 thousand per year until 2014. Let n be the number of patent applications (in thousands) during the year...

What kind of activities could a full-time college or university student pursue that might lead to the perception that he or she is a charismatic leader? In pursuing those activities, what might the...

The current market price of a stock is Rs . 6 0 , Stock may be 5 considered as non - dividend paying stock, The four - month forward price is Rs . 5 9 , The four - month interest rate is 5 % per...

What are diseconomies of scale? What is the main reason that firms may eventually encounter diseconomies of scale as they keep increasing the size of their store or factory?

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...

Draw the structures of an I U wobble pair and an I C wobble pair.

When a sequence of deoxynucleotides is entered into a translation program (such as the ExPASy Translate tool at www.expasy.org/tools/dna.html), six possible polypeptide sequences are given as...

In the current year, Plum Corporation, a computer manufacturer, dontated 100 laptop computers to a local school district (a qualified educational organizaiton). The computers were constructed by Plum...

illegal vs legal literals in java

You want to estimate the cost of equity of firm A using CAPM. Firm A has a beta of 1.3 and the standard deviation of returns is 17.81%. Assume that the return on the market portfolio is 8.52%, and...