For the conversion of reactant A to product B, the change in enthalpy is 7 kJ

Question:

For the conversion of reactant A to product B, the change in enthalpy is 7 kJ ∙ mol-1 and the change is entropy is 20 J ∙ K-1 ∙ mol-1. Above what temperature does the reaction become spontaneous?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals of biochemistry Life at the Molecular Level

ISBN: 978-0470547847

4th edition

Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt

See More Books

Question Posted: Apr 30, 2016 02:24 PM

See More Questions

Many biochemical reactions are catalyzed by large protein molecules called enzymes. A typical mechanism for the conversion of a biochemical substrate (S) to product (P) catalyzed by an enzyme (E)...
Give chemical equations for the conversion of carbon in coal to methane, CH4.
An important reaction for the conversion of natural gas to other useful hydrocarbons is the conversion of methane to ethane. 2CH4 (g) C2H6 (g) + H2 (g) In practice, this reaction is carried out in...
Segment Analysis Winston Sylvester Corporation is a brokerage and financial service company. The company recently provided information about its major business segments as follows (in millions):...
Use any print or CATR service or the Internet to find a Code section(s) on the following deduction topics. For each item, indicate the Code section number(s) and full title of the relevant Code...
Making the ratios look good J. Talbot is the accounting manager for Kolla Waste Disposal Corporation. Kolla is having its worst financial year since its inception. The company is expected to report a...
Nonparametric tolerance limits can be based on the extreme values in a random sample of size $n$ from any continuous population. The following equation relates the quantities $n, P$, and...
Consider the following data, which relate to the two divisions of McIntyre Products. Required Compare the two divisions in terms of return on investment and residual income. In the past year, which...
What are some strategies an interviewer can use to build rapport? What can be an issue if an applicant becomes too relaxed?
The acceleration ac 5 m/s2 is in the direction shown. From the velocity analysis, it was found that the angular velocity of members AB and BC are respectively @AB= 15 rad/s and @BC = 25 rad/s....
For the reaction A B at 298 K, the change in enthalpy is -7 kJ mol-1 and the change in entropy is -25 J K-1 mol-1. Is the reaction spontaneous? If not, should the temperature be increased or...
Draw a 3-dimensional structure of a water molecule, including any lone pairs of electrons, and indicate the dipole moment. What is the name of the geometrical figure have you drawn?
In Exercises 5053, rationalize the denominator. 2 3
For a short-circuit test on a 2-winding transformer, with one winding shorted, can you apply the rated voltage on the other winding? (a) Yes (b) No
Do prices tend to become more flexible or less flexible as time passes? Explain.
Are all prices in the economy equally inflexible? Which ones show large amounts of short-run flexibility? Which ones show a great deal of inflexibility over months or years?
Are labor costs a major fraction of the typical firms overall production costs? How does wage stickiness cause price stickiness? Discuss why firms are averse to cutting wages and salaries during a...
If real GDP grows at 7 percent per year, then real GDP will double in approximately ________ years. a. 70 b. 14 c. 10 d. 7
Use a spreadsheet to determine the 10-day SMA. 19.32 31-Mar 19.92 8-Apr 19.00 16-Apr 18.72 24-Apr 19.14 2-May 18.69 17-Apr 19.05 25-Apr 19.11 5-May 19.10 1-Apr 20.33 9-Apr 2-Apr 19.95 10-Apr 18.77...
On January 1, 2018, Khalid Ltd., which follows IAS 17, entered into an eight-year lease agreement for three dryers. Annual lease payments for the equipment are $28,500 at the beginning of each lease...
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
Draw the structures of an I U wobble pair and an I C wobble pair.
When a sequence of deoxynucleotides is entered into a translation program (such as the ExPASy Translate tool at www.expasy.org/tools/dna.html), six possible polypeptide sequences are given as...
As a HR manager identify and assess the drivers of high and low employment engagement. Support your arguments with specific examples. Please leave reference.
How does digital technology influence both the issues of credentialism and social/cultural reproduction? Does the technology help students? Does it hurt students? Please defend your answers using...
Using the four-drive motivation theory, as described by McShane, discuss how this experience is impacting Sophia's motivation ?

For the conversion of reactant A to product B, the change in enthalpy is 7 kJ

Question:

Step by Step Answer:

In order for G to have a n...View the full answer

Fundamentals of biochemistry Life at the Molecular Level

Students also viewed these Medical Sciences questions