Indicate the 10 region, the 35 region, and the initiating nucleotide on the sense strand of the E coli tRNATyr promoter shown below 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3 GTTGCATTGTGAAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTAT 5...

The top strand is the sense strand Its TATGAT segmen ...

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the

Question:

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals of biochemistry Life at the Molecular Level

ISBN: 978-0470547847

4th edition

Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt

See More Books

Question Posted: Apr 30, 2016 02:56 PM

See More Questions

Shown is a representation of a DNA molecule being transcribed? a. Identify every 3² end and every 5² end in the picture. b. Identify the template strand. c. Te non template strand is also...
The following DNA sequence occurs in a bacterium (the promoter sequence is located to the left but is not shown). 5-CAATCATGGACTGCCATGCTTCATATGAATAGTTGACAT-3...
Most humans are infected with herpes simplex virus-1 (HSV-1), the causative agent of cold sores. The HSV-1 genome comprises about I 00 genes, most of which are expressed in infected host cells at the...
Show that 1. Every differentiable concave function is pseudoconcave. 2. Every pseudoconcave function is quasiconcave
Lynn bought 100 shares of Filidelphia Corporation stock for $10,000 three years ago. On December 24, she sells 50 shares for $4,000. She plans to buy 100 more shares of Filidelphia stock for $7,000...
If the time value of money is so important, why isnt the timing of cash flows emphasized in the accounting cycle?
Water flows from a nozzle with a speed of $V=10 \mathrm{~m} / \mathrm{s}$ and is collected in a container that moves toward the nozzle with a speed of $V_{c v}=2 \mathrm{~m} / \mathrm{s}$ as...
Is one equivalent unit computation sufficient for all cost components? Explain your answer.
On January 1, 2023, Bertrand, Incorporated, paid $70,800 for a 40 percent interest in Chestnut Corporation's common stock. This Investee had assets with a book value of $235,000 and liabilities of...
Use Cereals file. This data shows calories and ingredients of each cereal available in store. Carbs, sugars, and fibers are measured as gram/serving and Sodium content milligram/serving. Find the...
Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms of a protein. Explain how one gene can code for two different forms of a protein.
Why does promoter efficiency tend to decrease with the number of G C base pairs in the - 10 region of a prokaryotic gene?
Nadia died in 2012 and is survived by her husband, Jerold (age 44); her married son, Travis (age 22); and her daughter-in-law, Macy (age 18). Jerold is the executor of his wife's estate. He maintains...
How do organizations get feedback regarding their promotions via the Internet? Find several examples of ways of providing sports marketers with feedback about their promotions.
What are the organizational design elements that must be managed for effective implementation?
Find an example of a comparative advertisement. What do you believe are the advantages and disadvantages of this type of message?
Describe the typical profile of spectators of womens sporting events. How would a sports marketer use this information in the strategic sports marketing process?
How can we evaluate sponsorship effectiveness?
Copper K radiation consists of two components of wavelengths 154.433 pm and 154.051 pm. Calculate the separation of the diffraction lines arising from the two components in a powder diffraction...
Difference between truncate & delete
Trans-2-Butene does not exhibit a signal in the double bond region of the spectrum (16001850 cm -1 ); however, IR spectroscopy is still helpful in identifying the presence of the double bond....
As explained previously, the concentration of an alcohol can be selected such that both a broad signal and a narrow signal appear simultaneously. In such cases, the broad signal is always to the...
For each of the following IR spectra, identify whether it is consistent with the structure of an alcohol, a carboxylic acid, or neither. a. b. c. d. e. f. 100- 80- 60- 40 20- 0. 2000 4000 3500 3000...
Reflect on a group interview you've had: * Was there anything you struggled with in preparing for the peer interviews? * What would you have changed about your interview? What would you have kept the...
Please conduct comprehensive research on the status of Metaverse, Choose a company, an industry, a product, or a service, and Share the strategies being used in Metaverse to develop a competitive...
Renovation and Restoration of community Park project For Risk management plan External risk : Budget Fluctuations in local economy Environment disasters Internal Risk: Safety Not enough money, staff...

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the

Question:

5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3 GTTGCATTGTGAAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTAT 5

Step by Step Answer:

The top strand is the sense strand Its TATGAT segmen...View the full answer

Fundamentals of biochemistry Life at the Molecular Level

Students also viewed these Medical Sciences questions