Question: In site-directed mutagenesis experiments, Gly is often successfully substituted for Val, but Val can rarely substitute for Gly. Explain.

In site-directed mutagenesis experiments, Gly is often successfully substituted for Val, but Val can rarely substitute for Gly. Explain.

Step by Step Solution

★★★★★

3.38 Rating (167 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

Because the side chain of Gly is only an H atom i... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Document Format (1 attachment)

Word file Icon

930-M-S-B-C (1070).docx

120 KBs Word File

Students Have Also Explored These Related Biochemistry Questions!

Q:

All of the homeotic genes in Drosophila have been cloned. As discussed in Chapter 20, cloned genes can be manipulated in vitro. They can be subjected to cutting and pasting, site-directed...

Q:

What does site-directed mutagenesis allow you to do that normal mutagenesis does not?

Q:

You are performing site-directed mutagenesis to test predictions about which residues are essential for a protein's function. Which of each pair of amino acid substitutions listed below would you...

Q:

9. In three separate site-directed mutagenesis experiments, scientists altered a Lys residue in corn PEP carboxylase to an Asn, Glu, or Arg. Which substitution would you expect to have the least...

Q:

In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish to change a putative active site histidine residue to a proline by site-directed mutagenesis. The...

Q:

Site-directed mutagenesis is used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid...

Q:

Site-directed mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino...

Q:

A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...

Q:

Identify which of the following are examples of reverse genetics. RNA interference gene knockout using site-directed mutagenesis mutation from wildtype allele to mutant allele DNA microarray mutation...

Q:

Let's suppose you want to use site-directed mutagenesis to investigate a DNA sequence that functions as a response element for hormone binding. From previous work, you have narrowed down the response...

Q:

Select a publicly traded company and access its most recent financial statements from its annual report. Include the name of the company in your subject line, and do not choose a company about which...

Q:

P2- For the circuit in the figure ri2 ri3 vi A2 are given. What is the appropriate amplifier type of A2? (voltage, current, trans-conductance, trans-resistance) ro2

Q:

ABC Corp. extends credit terms of 4 5 days to its customers. Its credit collection would be considered poor if its average collection period was: 3 0 days 3 6 days 4 6 days 5 7 days

Q:

The data shown in Table 6-15 represent the thrust of a jet-turbine engine (y) and six candidate regressors: x1 primary speed of rotation, x2 secondary speed of rotation, x3 fuel flow rate, x4 ...

Q:

Rice plants that have been engineered to overexpress alanine aminotransferase need about two-thirds less fertilizer than control plants. What does this information reveal about the process of...

Q:

Mouse embryonic stem cells produce high levels of threonine dehydrogenase, whose activity appears to be essential for maintaining high levels of S-adenosylmethionine. Explain the link between...

Q:

Proliferating cells require NADPH for biosynthetic processes. Much of the NADPH is provided by the pentose phosphate pathway, but 10-formyl tetrahydrofolate is also a source of reducing power....

Q:

Cream and Crimson has a capital structure of 4 0 % debt and 6 0 % equity. The tax rate is 3 4 % . The firm s bonds currently trade in the market for $ 1 1 8 4 . These $ 1 , 0 0 0 par value bonds have...

Q:

the -2010 period. Q3). (CLO1,2) Inventory management Wilkins Manufacturing has annual sales of $4 million and a gross profit margin of 40%. Its end-of-quarter inventories are Quarter Inventory...

Q:

A 1987 advertisement in the New Yorker solicited offers on a 1967 Mercury Cougar XR7 (Motor Trend's 1967 car of the year) that had been stored un-driven in a climate controlled environment for 20...