Question: Match the codon with the anticodon: Codon Anticodon AAA................. ACC GCA................. CCU CUU................. UUU AGG................. AGG CCU................. UGA GGU................. AAG UCA................. GUC GAC................. UGC

Match the codon with the anticodon:
Codon Anticodon
AAA................. ACC
GCA................. CCU
CUU................. UUU
AGG................. AGG
CCU................. UGA
GGU................. AAG
UCA................. GUC
GAC................. UGC

Step by Step Solution

★★★★★

3.37 Rating (166 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

AAA GCA CUU ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

948-C-O-C-R-O-A (2263).docx

120 KBs Word File

Students Have Also Explored These Related Organic Chemistry Questions!

In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These mutations can change the sequence of the anticodon. For example, a normal tRNAlrpgene would encode a tRNA...

Match the air volumes with their descriptions: (1) tidal volume A. air that remeins aner most forceful expiration | B volume of aic i addition to resting tidal volume, that can enter (2 inspintory...

Define codon and anticodon. How do they interact?

For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid sequences that have been left blank. 1. DNA MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AA 2. DNATAC CGC...

For this task, you will need the following dictionary file: codon.tsv. It contains 64 lines, each with two columns. In the first column are the codons, and in the second are the corresponding amino...

Please help me answer these questions accurately. I would really appreciate it and will leave a great review!! ?????? Exercise 3: Protein Synthesis Protein synthesis is the process used by the body...

In wild type E. coli a 3'- G-T-A- 5' triplet of DNA nucleotides is transcribed into a codon that is translated into an amino acid in a functioning polypeptide. If there is a nucleotide pair...

You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below: 3CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5 Additional tools are provided below. a)...

The gene GALK1 in human encodes the enzyme galactokinase 1. This enzyme enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is...

xercise 3 # The gene GALK1 in human encodes the enzyme galactokinase 1. This enzyme enables the body to process a simple sugar called galactose, which is present in small amounts in many foods....

18. The volume of a cone is 462 cm3. If its height is 9 cm. Calculate it radius.

Distinguish between the two bases that may be used in estimating uncollectible accounts.

Once a month the childrens Hospital allows volunteers to come, and join the children for lunch. These lunchons usually have a theme, such as Valentines Day or May day. However, they all have one...

The following compound is not aromatic even though it has 4n + 2 electrons in a continuous cyclic array. Explain why this compound is not aromatic.

Rank the isomers within each set in order of increasing heat of formation (lowest first). CH-CH,

Assume you have unlabeled samples of the compounds within each of the following sets. Explain how UV-vis spectroscopy could be used to distinguish each compound in the set from the other (s). (a) (b)...

A trial evaluated the fever-inducing effects of three substances. Study subjects were adults seen in an emergency room with diagnoses of the flu and body temperatures between 100.0 and 100.9F. The...

Assume Evco, Inc., has a current stock price of $ 4 6 and will pay a $ 2 . 1 5 dividend in one year; its equity cost of capital is 1 7 % . What price must you expect Evco stock to sell for...

Problem 10-11 MIRR and NPV Your company is considering two mutually exclusive projects, X and Y, whose costs and cash flows are shown below: Year X Y 0 -$5,000 -$5,000 1 1000 4,500 2 1500 1500 3 2000...