New Semester
Started
Get
50% OFF
Study Help!
--h --m --s
Claim Now
Question Answers
Textbooks
Find textbooks, questions and answers
Oops, something went wrong!
Change your search query and then try again
S
Books
FREE
Study Help
Expert Questions
Accounting
General Management
Mathematics
Finance
Organizational Behaviour
Law
Physics
Operating System
Management Leadership
Sociology
Programming
Marketing
Database
Computer Network
Economics
Textbooks Solutions
Accounting
Managerial Accounting
Management Leadership
Cost Accounting
Statistics
Business Law
Corporate Finance
Finance
Economics
Auditing
Tutors
Online Tutors
Find a Tutor
Hire a Tutor
Become a Tutor
AI Tutor
AI Study Planner
NEW
Sell Books
Search
Search
Sign In
Register
study help
medical sciences
biochemistry
Fundamentals of biochemistry Life at the Molecular Level 4th edition Donald Voet, Judith G. Voet, Charlotte W. Pratt - Solutions
When a sequence of deoxynucleotides is entered into a translation program (such as the ExPASy Translate tool at www.expasy.org/tools/dna.html), six possible polypeptide sequences are given as results. Explain.
The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S rRNA residues A1492 and A1493 as are induced by codon-anticodon pairing (Fig. 27-32). Propose an explanation for the antibiotic effect of paromomycin.
The rate of the peptidyl transferase reaction increases as the pH increases from 6 to 8. Explain these results in terms of its reaction mechanism.
It has been proposed that residue A2486 is protonated and therefore stabilizes the tetrahedral reaction intermediate. Is this mechanistic embellishment consistent with the observed pH effect? Explain.
Cells can make certain oligopeptides using conventional enzymes rather than mRNA-directed translation by a ribosome. Draw the product of the reaction catalyzed by L-glutamate:L-cysteine gamma-ligase (γ-glutamylcysteine synthetase).
All cells contain an enzyme called peptidyl-tRNA hydrolase, and cells that are deficient in the enzyme grow very slowly. What is the probable function of the enzyme and why is it necessary?
Genetically engineered mRNAs that code for a stretch of basic residues, such as poly(Lys), induce translation termination and destruction of the nascent polypeptide. Explain how this response would protect cells from the effect of faulty transcription that produces mRNAs with mutated Stop codons.
Calculate the energy required, in ATP equivalents, to synthesize a 100-residue protein from free amino acids in E. coli (assume that the N-terminal Met remains attached to the polypeptide and that no ribosomal proofreading occurs).
Design an mRNA with the necessary prokaryotic control sites that codes for the octapeptide Lys-Pro-Ala-Gly-Thr-Glu-Asn-Ser.
Which amino acids are specified by codons that can be changed to a UAG Stop codon by a single point mutation?
Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is(are) most likely to be used this way?
A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues
The sequence of the sense strand of a mammalian gene is TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAGCACAGGCATGCAGGGATATCCTCCAAAAAG GTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT Determine
The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?
Given its mechanisms, explain how RNAi might act catalytically
Not counting variation due to hypermutation and the addition and deletion of nucleotides at the junctions between V, D, and J segments, what is the total possible number of different antibodies that a human can produce? Assume that the number of possible λ chains is the same as the number of
How do mutations resulting in nonfunctional ATM predispose individuals to cancer?
Inactivation of the eukaryotic proto-oncogene c-myc involves premature termination of its RNA transcripts near the promoter. What feature of this phenomenon is likely to be similar to attenuation in prokaryotes? What feature must be different?
Why is it important that cells other than reticulocytes not synthesize heme-controlled repressor?
Based on the information in Figure, what percentage of known human genes are involved in signal transduction?
Match the following genes involved in Drosophila development with the statements below. A. Homeotic genes B. Pair-rule genes C. Gap genes D. Segment polarity genes _____ Gradients of these gene products define the polarity of body segments. _____ A deletion in one of these genes converts an
How do Bicoid and Nanos proteins determine the differential expression of the giant, Krüppel, and knirps genes?
How might recombination during meiosis result in the expansion of trinucleotide repeats?
What observation indicates that transcription of the lac operon is never completely repressed?
A mutation in which element of the lac operon (P, O, Z, Y, A) and/or the lac repressor gene (I) will lead to constitutive expression of the structural genes of the operon? Explain.
Imagine a culture of E. coli grown for many generations in the presence of glucose and absence of lactose. How do these bacteria "turn on" the lac operon if the permease gene has been "off" for so long?
What mechanisms have been observed in riboswitches for the inhibition of gene expression?
DNA isolated from an organism can be sheared into fragments of uniform size (1000 bp), heated to separate the strands, then cooled to allow complementary strands to reanneal. The renaturation process can be followed over time. Explain why the renaturation of E. coli DNA is a monophasic process
Describe the probable genetic defect that abolishes the sensitivity of the lac operon to the absence of glucose when other metabolic operons continue to be sensitive to the absence of glucose.
Why can't eukaryotic transcription be regulated by attenuation?
Predict the effect of deleting the leader peptide sequence on regulation of the trp operon.
Red-green color blindness is caused by an X-linked recessive genetic defect. Hence females rarely exhibit the red-green colorblind phenotype but may be carriers of the defective gene. When a narrow beam of red or green light is projected onto some areas of the retina of such a female carrier, she
Draw the molecular formula of the covalently modified histone side chain of acetyllysine. How does this modification alter the chemical properties of the side chain?
Draw the molecular formulas of the covalently modified histone side chains of methyllysine and methylarginine. How do these modifications alter the chemical properties of the side chains?
Explain why a deficiency of the vitamin folic acid could lead to undermethylation of histones and DNA.
Monomethylation of histone Arg residues can be reversed by the action of a peptidylarginine deiminase, which requires water to remove the methyl group along with the imino group of Arg. Draw the structure of the resulting amino acid side chain and identify this nonstandard amino acid.
Is it possible for a transcription enhancer to be located within the protein-coding sequence of a gene? Explain.
Explain why the organization of genes in operons facilitates the assignment of functions to previously unidentified ORFs in a bacterial genome.
Proliferation and differentiation of T and B lymphocytes during an immune response are mediated by signaling that leads to phosphorylation of a protein called IKB. Unphosphorylated IKB binds to and inhibits the transcription factor NF-KB. Phosphorylated IKB releases NF-KB and is then ubiquitinated
Explain why natural selection has favored the instability of RNA.
Explain why RNAi would be a less efficient mechanism for regulating the expression of specific genes if Dicer hydrolyzed double-stranded RNA every 11 bp rather than every 22 bp.
How many different heavy chain variable regions can theoretically be generated by somatic recombination in humans (ignore junctional flexibility)? If each of these heavy chains could combine with any of the ~2000 K light chains, how many different immunoglobulins could be produced?
V/D/J recombination frequently yields a gene whose mRNA cannot be successfully translated into an immunoglobulin chain. What aspect of somatic recombination is likely to produce nonproductive gene rearrangement?
B cells suppress the expression of all but one heavy chain allele and one light chain allele, a process known as allelic exclusion, by inhibiting the further somatic recombination of heavy and light chain genes after a productive recombination has occurred. Describe the aberrant properties of
Explain what might happen if the activation-induced cytidine deaminase (AID) were activated in a cell other than a B cell.
Why is it disadvantageous for single-celled eukaryotes such as yeast to undergo apoptosis?
During apoptosis, phosphatidylserine (Section 9-1C) undergoes transverse movement (flip-flop). Explain why this could help identify apoptotic cells to phagocytic cells for engulfment and disposal.
In Drosophile, an esc- homozygote develops normally unless its mother is also an esc- homozygote. Explain.
The genome of Daphnia pulex, a small freshwater crustacean, includes approximately 30,000 genes in ~200,000 kb of DNA. How does the genome compare to that of Drosophila melanogaster, another arthropod, and to that of humans?
A possible mechanism for the pathology of trinucleotide repeat diseases is aberrant translation in which all three reading frames are used. Which repeating amino acid residues will result from the translation of transcripts made from repeating DNA sequences of (a) CAG (b) CTG?
Explain why (a) Inactivation of the O2 or O3 sequence of the lac operon causes only a twofold loss in repression, and (b) Inactivation of both O2 and O3 reduces repression ~70-fold.
Showing 1800 - 1900
of 1848
First
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
Step by Step Answers
Get 50% OFF
Claim Now
.png)
.png)
