New Semester
Started
Get
50% OFF
Study Help!
--h --m --s
Claim Now
Question Answers
Textbooks
Find textbooks, questions and answers
Oops, something went wrong!
Change your search query and then try again
S
Books
FREE
Study Help
Expert Questions
Accounting
General Management
Mathematics
Finance
Organizational Behaviour
Law
Physics
Operating System
Management Leadership
Sociology
Programming
Marketing
Database
Computer Network
Economics
Textbooks Solutions
Accounting
Managerial Accounting
Management Leadership
Cost Accounting
Statistics
Business Law
Corporate Finance
Finance
Economics
Auditing
Tutors
Online Tutors
Find a Tutor
Hire a Tutor
Become a Tutor
AI Tutor
AI Study Planner
NEW
Sell Books
Search
Search
Sign In
Register
study help
medical sciences
biochemistry
Biochemistry 8th edition Mary K. Campbell, Shawn O. Farrell - Solutions
What are replication licensing factors? How did they get their name?
Is DNA synthesis likely to be faster in prokaryotes or in eukaryotes?
In the Meselson–Stahl experiment that established the semiconservative nature of DNA replication, the ex-traction method produced short fragments of DNA. What sort of results might have been obtained with longer pieces of DNA?
What is the difference between s70 and s32?
What is the function of the catabolite activator protein?
What is transcription attenuation?
What role does an operon play in the synthesis of enzymes in prokaryotes?
Give an example of a system in which alternative σ factors can control which genes are transcribed. Explain how this works.
Explain, with diagrams, how transcription attenuation works in the trp operon.
List three important properties of RNA polymerase from E. coli.
What are various ways that a ribo-switch shuts off translation when it binds to its target molecule?
How is the discovery of riboswitches relevant to bacterial pathology?
Define exon and intron.
What are some of the main differences between transcription in prokaryotes and in eukaryotes?
List the components of eukaryotic Pol II promoters.
What are the functions of TFIIH?
What is the purpose of CREB?
How does regulation of transcription in eukaryotes differ from regulation of transcription in prokaryotes?
What is the mechanism of transcription attenuation?
How do the roles of enhancers and silencers differ from each other?
How do response elements modulate RNA transcription?
Explain the relationship between TFIID, TBP, and TAFs.
Explain the different ways in which eukaryotic transcription elongation is controlled.
Explain the importance of CREB, giving examples of genes activated by it.
What is mediator and how does it work?
Why are histone modifying enzymes important?
What are the major types of covalent modification of histones?
What are the different terms used to describe the two strands of DNA involved in transcription?
What are small interfering RNAs?
Why do scientists think that RNA silencing is an evolutionarily conserved process?
How is miRNA-206 beneficial to an organism?
Define promoter region and list three of its properties.
Give examples of the major structural motifs in DNA-binding proteins, and explain how they bind.
What roles can RNA play, other than that of transmission of the genetic message?
Explain how differential splicing of RNA is thought to be relevant to the information gathered from the Human Genome Project.
What is a ribozyme? List some examples of ribozymes.
Outline a mechanism by which RNA can catalyze its own self-splicing.
Distinguish between rho-dependent termination and intrinsic termination.
Diagram a section of DNA being transcribed. Give the various names for the two strands of DNA.
Is it reasonable that codons for the same amino acid have one or two nucleotides in common? Why or why not?
Why would IAV evolve to be less lethal?
Explain how a frameshift in reading mRNA affects the translation of the mRNA for the IAV viral protease.
Outline the proofreading processes in amino acid activation.
What ensures fidelity in protein synthesis? How does this compare with the fidelity of replication and transcription?
Suggest a reason why the proofreading step in protein synthesis takes place at the level of amino acid activation rather than that of codon–anticodon recognition.
Identify the following by describing their functions: EF-G, EF-Tu, EF-Ts, EF-P, and peptidyl transferase.
What are the components of the initiation complex in protein synthesis? How do they interact with one another?
What are the A site and the P site? How are their roles in protein synthesis similar? How do they differ? What is the E site?
What is the Shine–Dalgarno sequence? What role does it play in protein synthesis?
(a) How many activation cycles are needed for a protein with 150 amino acids?(b) How many initiation cycles are needed for a protein with 150 amino acids?(c) How many elongation cycles are needed for a protein with 150 amino acids?(d) How many termination cycles are needed for a protein with 150
What is the energy cost per amino acid in prokaryotic protein synthesis? Relate this to low entropy.
Would it be possible to calculate the cost of protein synthesis, including the cost of making mRNA and DNA?
Suggest a possible conclusion from the fact that peptidyl transferase is one of the most conserved sequences in all of biology.
How can the binding assay technique be used to assign coding triplets to the corresponding amino acids?
Why is selenocysteine called the 21st amino acid when there are many more amino acids found than the 20 basic ones coded for by the genetic code?
What is unique about selenocysteine?
What are two major similarities between protein synthesis in bacteria and in eukaryotes? What are two major differences?
Protein synthesis takes place much more slowly in eukaryotes than in prokaryotes. Suggest a reason why this is so.
How does the strength of an incoming nerve impulse affect memory?
Why do scientists now believe that AUG is not always the start codon?
Describe the role of stop codons in the termination of protein synthesis.
Is it reasonable to expect that protein degradation can take place at any location in a cell?
What is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?
Consider a three-base sequence in the tem-plate of DNA: 5' . . . 123 . . . 3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides. Comment on the probable effect on the resulting protein if the following point mutations (one-base substitutions) occurred. (a) Changing one
How does protein degradation play a role in how we adapt to high altitude?
What are sticky ends? What is their importance in recombinant DNA technology?
What would be an advantage of using HaeIII for a cloning experiment? What would be a disadvantage?
Describe the method you would use to test for the uptake of a plasmid with a DNA insert.
What is blue/white screening? What is the key feature of a plasmid that is used for it?
What are some of the dangers of (and precautions against) recombinant DNA technology?
Using information we have seen about lactate dehydrogenase, how could you clone and express human lactate dehydrogenase 3 (LDH 3) in bacteria?
What are the requirements for an expression vector?
What is a fusion protein? How are fusion proteins involved in cloning and expression?
The genes for both the a- and b-globin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for a-globin into a bacterial plasmid and have the bacteria produce a-globin?
When proteins are separated using native gel electrophoresis, size, shape, and charge control their rate of migration on the gel. Why does DNA separate based on size, and why do we not worry much about shape or charge?
What are the differences between a DNA library and a cDNA library?
Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?
What are the criteria for “good” primers in a PCR reaction?
Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'(c) Forward primer 5'
What is the functional difference between regular PCR and qPCCR?
Suppose that you are a prosecuting attorney. How has the introduction of the polymerase chain reaction changed your job?
Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code
Sometimes knowing the DNA sequence of a gene that codes for a protein does not tell you the amino acid sequence. Suggest several reasons why this is so.
A television commercial featuring former cyclist Lance Armstrong talked about the possibility of people carrying a DNA genotype card with them that would contain all of the information necessary to predict future diseases. This could, therefore, be used to help prescribe drugs to stop a medical
Explain how a DNA microchip works.
If you wanted to study the nature of transcription in yeast under aerobic versus anaerobic conditions, how could you use DNA microarrays to accomplish this?
How are DNA microarrays used to screen a patient’s cells for a cancer prognosis?
What are the key differences between DNA microarrays and protein microarrays, and how they are used in research?
What role did restriction endonucleases play in localizing the gene associated with cystic fibrosis?
Where did restriction endonucleases get their name?
What do the following have in common? MOM; POP; NOON; MADAM, I’M ADAM; A MAN, A PLAN, A CANAL: PANAMA.
What are the two types of gene therapy?
What are the potential hazards of gene therapy?
What are the considerations for choice of a vector in gene therapy?
Both ADA-SCID and type I diabetes are diseases based on lack of a particular protein. Why has the pioneering work on gene therapy focused on SCID instead of on diabetes?
What health conditions are linked to malfunctioning immune systems?
Define the following:(a) Virion(b) Capsid(c) Nucleocapsid(d) Protein spike
What is innate immunity? What is acquired immunity?
Describe the relationship between the innate immunity system and the acquired-immunity system.
One of the first human proteins cloned was interferon. Why would it be important to be able to produce interferon in a lab?
Showing 200 - 300
of 1848
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Last
Step by Step Answers