Scientists at the Centers for Disease Control and Prevention (CDC) concluded that NY99 most likely was transported

Question:

Scientists at the Centers for Disease Control and Prevention (CDC) concluded that NY99 most likely was transported to New York from Israel. Does the information in the following table support this conclusion? How many differences in sequence are there between the two samples? What other conclusion could you draw from comparing the NY99 and ISRAEL98 strains?

NY99 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATT ISRAEL98 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGG

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For  book-img-for-question

Campbell Biology

ISBN: 978-0321775658

10th edition

Authors: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson

Question Posted: