A population has mean = 10 and standard deviation = 4. a. Find the z-score

Question:

A population has mean μ = 10 and standard deviation σ = 4.

a. Find the z-score for a population value of 14.

b. Find the z-score for a population value of 8.

c. What number has a z-score of 1.5?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Elementary Statistics

ISBN: 9781259969454

3rd Edition

Authors: William Navidi, Barry Monk

See More Books

Question Posted: May 03, 2024 04:02 AM

See More Questions

Write a program that read a sequence of integer inputs and print (20 Points) a) The Smallest and largest of the inputs. b) The number of even and odd inputs. c) Cumulative totals. For example, if the...
28. The best explanation for the titration results represented by the following graph is Hd 14 13 12 10 9 8 7 6 5 4 3 2 1 0 0 Titration Curve for Titration of 37 mL of 0.10 mol/L H3PO4(aq) with...
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
choess answaer that How many bits are required to store one BCD digit?" 2 8 1 Kilo bits are equal to 1000 bits 1024 bits 1012 bits 1008 bits The function of the encoder is to convert coded...
Kent Market (KM) is a major food cooperative. Suppose KM begins 2017 with cash of $5 million. KM estimates cash receipts during 2017 will total $103 million. Planned payments will total $93 million....
Campbell Motors is an auto dealership that specializes in the sale of station wagons and light trucks. Because of its reputation for quality and service, Campbell has a strong position in the...
Diagram the flow of data within the cashier's department when a company has both over-the-counter and mail receipts.
Dave Matthew Inc. issues 500 shares of $10 par value common stock and 100 shares of $100 par value preferred stock for a lump sum of $100,000. Instructions (a) Prepare the journal entry for the...
W Find the profit function for the given marginal profit and initial condition. P(x) = Marginal Profit Initial Condition dP =-40x + 290 P(4) = $610 dx
A population has mean = 30 and standard deviation = 6. a. Find the z-score for a population value of 21. b. Find the z-score for a population value of 42. c. What number has a z-score of 0.5?
Four employees in an office have annual salaries of $$30,000$, $$35,000$, $$45,000$, and $70,000. a. Compute the sample standard deviation of the salaries. b. Each employee gets a $$1000$...
What happens if transactions are not voluntary? Can you give an example of a transaction that might not be voluntary?
[a] Given the following data: xi Y; 1 1.25 1.5 1.75 5.10 N 5.79 6.53 7.45 8.46 Construct the least squares approximation of the form y-a ex, then find y(2.5). [b] Use best approximation for the first...
LJ, married, has two dependent minor brothers. He is a partner of a general professional partnership. He is also engaged in trading business of his own. The following data were provided by LJ in...
Identify which account(s) have been erroneously included in the trial balance below by putting an 'X' next to the line in error. Callaho Inc. Post-Closing Trial Balance July 31, 2014 Accounts...
a) (i) b) (1) (ii) (iii) (iv) (v) (vi) c) (i) (iii) (iv) (v) (vi) d) (i) (ii) (iii) (iv) (v) (vi) Differentiate between the following terms Homogenous and non-homogenous differential equations A...
Assume the restaurant has a production technology q = 5L0.40.3 1.1 If Jackie has hired 3 employees L = 3 and bought 8 kitchen appliances K = 8. Calculate the number of meals q that she can produce....
Report to the class on the achievements of Daniel Bernoulli.?
Question 6.10 Current and deferred tax worksheets and tax entries From the hip Ltd?s statement of profit or loss for the year ended 30 June 2007 and extracts from its statements of financial position...
Find the compound interest and future value. Round your answers to the nearest cent. Do not round intermediate steps. Principal Rate Compounded Time $520 4.85% Quarterly 6 years The future value is $...
1.Calculate the present value (principal) and the compound interest (in $). Use Table 11-2. Round your answers to the nearest cent. a. Compound Amount Term of Investment Nominal Rate (%) Interest...
Decontaminate the messages that follow the Guidelines by rewriting them in a way that makes them whole (separate out each type of relevant expression). You can fill in details, if needed, to make...

A population has mean = 10 and standard deviation = 4. a. Find the z-score

Question:

Step by Step Answer:

Elementary Statistics

Students also viewed these Business questions