Question: A population has mean = 10 and standard deviation = 4. a. Find the z-score for a population value of 14. b. Find

A population has mean μ = 10 and standard deviation σ = 4.

a. Find the z-score for a population value of 14.

b. Find the z-score for a population value of 8.

c. What number has a z-score of 1.5?

Step by Step Solution

★★★★★

3.43 Rating (156 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

a To find the zscore we use the formula z X where X is the population value is the mean an... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Elementary Statistics Questions!

Q:

Write a program that read a sequence of integer inputs and print (20 Points) a) The Smallest and largest of the inputs. b) The number of even and odd inputs. c) Cumulative totals. For example, if the...

Q:

28. The best explanation for the titration results represented by the following graph is Hd 14 13 12 10 9 8 7 6 5 4 3 2 1 0 0 Titration Curve for Titration of 37 mL of 0.10 mol/L H3PO4(aq) with...

Q:

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Q:

10. A value that is two standard deviations below the mean will have a z-score of____________. 17) A normal population has mean = 20 and standard deviation = 4. a. What proportion of the population...

Q:

Question1 :A random sample is drawn from a normally distributed population with mean = 17 and standard deviation = 2.1. [You may find it useful to reference the z table .] a. Are the sampling...

Q:

Consider a normally distributed population with mean / = 10 and standard deviation o = 2.5. Suppose a random sample of size n is selected from this population. Let n = 12. Find the mean my and the...

Q:

A normally distributed population has mean 57,800 and standard deviation 750. 1. Find the probability that a single randomly selected element X of the population is between 57,000 and 58,000. 0-4621...

Q:

A random sample of size n = 50 is taken from a population with mean = 9.5 and standard deviation = 2. [You may find it useful to reference the z table .] a. Calculate the expected value and the...

Q:

Please compute the following Find the z-value for the following mean taken from a population with mean 40 and standard deviation 4: xbar = 45, n = 100 Question 2 Find the z-value for the following...

Q:

Please compute the following Find the z-value for the following mean taken from a population with mean 40 and standard deviation 4: xbar = 45, n = 100 Question 2 Find the z-value for the following...

Q:

Eateries Regina Ltd. (ERL) operates restaurants in several Saskatchewan cities. The accountant responsible for ERLs long lived assets and liabilities has been on medical leave since January 1, 2020....

Q:

For a company that produces desktop computers, would memory chips be considered a direct or indirect materials cost of each computer produced?

Q:

Silicon Valley Bank (SVB) suffered a bank run and ultimately collapsed in early 2023. Why did the bank collapse? Who bought out SVB? What would you have done if you had funds deposited in SVB

Q:

How do an income statement and a statement of cash flows differ? How are they similar?

Q:

A variable is normally distributed with mean 6 and standard deviation 2. a. Determine and interpret the quartiles of the variable. b. Obtain and interpret the 85th percentile. c. Find the value that...

Q:

The area under the density curve that lies between 15 and 20 is 0.414. What percentage of all possible observations of the variable are either less than 15 or greater than 20?

Q:

A variable is normally distributed with mean 68 and standard deviation 10. a. Determine and interpret the quartiles of the variable. b. Obtain and interpret the 99th percentile. c. Find the value...

Q:

Study the scenario and complete the questions that follow: Implementing VLSM , VLAN Interconnection, OSPF Configuration Implementing VLSM , VLAN Interconnection, OSPF Configuration, and Connectivity...

Q:

You find a stock that just paid a dividend of $1.80 that is expected to grow at 20% per year for the next four years, then at a constant rate of 6%. If you require a return of 9%, what is the most...

Q:

Elmer received a $25,000 loan from a loan shark. The loan required him to make payments of $400 per week (52 weeks per year) for three years. What annual rate (APR) and effective annual rate (EAR)...