Question: A population has mean = 30 and standard deviation = 6. a. Find the z-score for a population value of 21. b. Find

A population has mean μ = 30 and standard deviation σ = 6.

a. Find the z-score for a population value of 21.

b. Find the z-score for a population value of 42.

c. What number has a z-score of 0.5?

Step by Step Solution

★★★★★

3.33 Rating (150 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

a Zscore for a value of 21 We can calculate the zscore using the formula z x where ... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Elementary Statistics Questions!

Q:

Write a program that read a sequence of integer inputs and print (20 Points) a) The Smallest and largest of the inputs. b) The number of even and odd inputs. c) Cumulative totals. For example, if the...

Q:

A Question 2 A steel beam extending beyond is upheld at points B and D, as depicted in Figure Q2(a). The beam's cross-sectional area is illustrated in Figure Q2(b). Answer the following questions: i....

Q:

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Q:

The Central Limit Theorem (Summarized) For a sampling distribution with sample size n that is drawn from any population with mean u and standard deviation 6 The distribution of sample means has the...

Q:

Question1 :A random sample is drawn from a normally distributed population with mean = 17 and standard deviation = 2.1. [You may find it useful to reference the z table .] a. Are the sampling...

Q:

A sample of size 60 will be drawn from a population with mean 31 and standard deviation 6. Use the TI-83 Plus/TI-84 Plus calculator. (a) Find the probability that ; will be more than 30. Round the...

Q:

A population has mean u=25 and standard deviation =6. Round the answers to two decimal places as needed. Part: 0 / 3 Part 1 of 3 (a) Find the z-score for a population value of 4. The z-score for a...

Q:

A normal population has mean= 10 and standard deviation= 6. A normal population has mean u= 10 and standard deviation a=6. (a) What proportion of the population is less than 21? (b) What is the...

Q:

Assume the random variable x is normally distributed with mean u = 50 and standard deviation 6 = 7. Find the indicated probability. P(x > 38) P(x > 38) = D (Round to four decimal places as needed.)...

Q:

Lesson UNDERSTANDING THE Z- 4 SCORES Learning Concept Let us begin understanding the z-scores by acknowledging that for a given distribution, it is more preferred to have a larger set of data in...

Q:

Find - F[ 543 +5+) G5+5) ) (

Q:

True or False? Albert Bandura argued that people may learn a lot more than they demonstrate. O a. False O b. True

Q:

17. Simplify each of the following, expressing your answers in positive index form. (a) x'y'z x'y'z x xyz 5. 6 (xyz7 5 (b) x yz + x3y x'y ab" (c) "db12 bc cd "13 + (d) (a+b)" (a+b)**3 #13 bc abc

Q:

What are the three forms of business organization? Briefly describe each form.

Q:

A variable is normally distributed with mean 68 and standard deviation 10. Find the percentage of all possible values of the variable that a. Lie between 73 and 80. b. Are at least 75. c. Are at most...

Q:

A variable is normally distributed with mean 10 and standard deviation 3. Find the percentage of all possible values of the variable that a. Lie between 6 and 7 b. Are at least 10 c. Are at most 17.5

Q:

A variable is normally distributed with mean 0 and standard deviation 4. Find the percentage of all possible values of the variable that a. Lie between 8 and 8 b. Exceed 1.5 c. Are less than 2.75

Q:

1.Briefly describe the agency problem that exists between owners and lenders. How do lenders cause firms to incur agency costs to resolve this problem? 2. Please provide 3 references?

Q:

Recall that on a one - year Treasury security the yield is 5 . 3 8 0 0 % and 8 . 0 7 0 0 % on a two - year Treasury security. Suppose the one - year security does not have a maturity risk premium,...

Q:

Which of the following is NOT true? Any gate can be used to build an SR Latch. Any digital circuit can be implemented by NAND gates only. NOR is a computation complete function. The Boolean...