Question: A mutation in DNA generates a UGA stop codon in the middle of the mRNA coding for a particular protein. A second mutation in the

A mutation in DNA generates a UGA stop codon in the middle of the mRNA coding for a particular protein. A second mutation in the cell’s DNA leads to a single nucleotide change in a tRNA that allows the correct translation of this protein; that is, the second mutation “suppresses” the defect caused by the first. The altered tRNA translates the UGA as tryptophan. What nucleotide change has probably occurred in the mutant tRNA molecule? What consequences would the presence of such a mutant tRNA have for the translation of the normal genes in this cell?

Step by Step Solution

★★★★★

3.26 Rating (155 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

The mutant tRNA would have to recognize and attach to the UGA stop codon instead of halting tran... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Essential Cell Biology Questions!

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Chapter 20 describes a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of...

Protein synthesis in eukaryotes normally begins at the first AUG codon in the mRNA. Sometimes, however, the ribo-somes do not begin protein synthesis at this first AUG but scan past it (leaky...

Regarding the question I asked for assitance with bellow: Part 1: Transcription and Translation: 1. Transcribe the following DNA sequence from HbA. 5' - AGT AAC GGC AGA CTT CTC CTC AGG AGT CAG GTG...

Part A Nucleotides have three parts: a phosphate group, a sugar, and a base. Label those parts in the nucleotide shown here. Drag each label to the appropriate target. View Available Hint(s) Reset...

answer this 8. You have isolated a novel mutant allele of the gene pic1. The normal product of this gene is a protein 600 amino acids long. Your mutant allele does produce a protein, but it is only...

8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5' A.) What is the MRNA sequence that would result from transcription of this sequence?...

Going through the motions... Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating each gene...

Bacterial DNA polymerase I and DNA polymerase III perform different functions during DNA replicatio a. Identify the principal functions of each molecule. b. If mutation inactivated DNA polymerase I...

Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it...

Use the Internet to research knowledge management systems. Specifically, (1) Find one example of a knowledge management system, (2) Identify the provider or vendor, (3) Provide the Web site URL, (4)...

Prepare partial income statements through gross profit, under each of the following cost flow assumptions. (1) Specific identification method assuming: (i) The March 5 sales consisted of 1,000 liters...