Describe the intra-and intermolecular bonds or interactions that are broken or retained when collagen is heated to

Question:

Describe the intra-and intermolecular bonds or interactions that are broken or retained when collagen is heated to produce gelatin.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals Of Biochemistry Life At The Molecular Level

ISBN: 9781118918401

5th Edition

Authors: Donald Voet, Judith G Voet, Charlotte W Pratt

See More Books

Question Posted: Oct 04, 2023 06:56 AM

See More Questions

A common and important process is the manufacture of gelatin for food, pharmaceuticals, photographic film, and various technical applications. The chemistry is the simple hydration of collagen from...
PART A) Gelatin is processed collagen that comes from the bone and joints of animals. Collagen is a structural protein consisting of a triple helix three polypeptide chains wound around each other....
(a) Which is generally stronger, intermolecular interactions or intramolecular interactions? (b) Which of these kinds of interactions are broken when a liquid is converted to a gas?
Determine A in the indicated figures. Fig. 2.40 (a) A 84 (a) 40 B
What are the three main tasks the operating system performs?
Explain the following observations: (a) The surface tension of CHBr3 is greater than that of CHCl3. (b) As temperature increases, oil flows faster through a narrow tube. (c) Raindrops that collect on...
Consider the National Football League data in Table B.1. a. Fit a multiple linear regression model relating the number of games won to the team's passing yardage $\left(x_{2} ight)$, the percentage...
1. Cash dividends on the $10 par value common stock of Garrett Company were as follows: 1st quarter of 2016 ...... $ 800,000 2nd quarter of 2016 ...... 900,000 3rd quarter of 2016 ...... 1,000,000...
Pitch a recommendation to a company of your choosing with your prediction of the potential success or downfall of Facebook and the MetaVerse for social media marketing. Essentially, would you...
The coat protein of tomato bushy stunt virus consists of 180 chemically identical subunits, each of which is composed of 386 amino acid residues. The probability that a wrong amino acid residue will...
The GroEL/ES cycle diagrammed in Fig. 6-45 circulates only in the clockwise direction. Explain the basis for this irreversibility in terms of the sequence of structural and binding changes in the...
Yvonne Sanchez borrowed money from MBank to purchase an automobile. She gave MBank a security interest in the vehicle as collateral to secure the loan. When Sanchez defaulted on the loan, MBank hired...
Let $W$ be a $\mathbb{P}$-Brownian motion, and $B_{t}=W_{t}+u t$ be a $\mathbb{Q}$-Brownian motion, under a suitable change of probability. Check that, in the case $u>0$, the process...
According to Googles Consumer Barometer, an interactive digital consumer insights tool, some 93 percent of UAE and Saudi Arabian under-35s go online using either smartphones or tablets. The 2018 data...
Prove that, more generally than (5.2.8), the dual predictable projection of $\int_{0}^{t} f\left(B_{s}^{(u)} ight) d s$ is \(\int_{0}^{t} \mathbb{E}\left(f\left(B_{s}^{(u)} ight) \mid...
See Exercise 1.7.1.8 for the notation. Prove that $B$ defined by \[d B_{t}=d W_{t}-\frac{\int_{-\infty}^{\infty} d y h^{\prime}(y) e^{-\left(y-W_{t} ight)^{2} /(2(T-t))}}{\int_{-\infty}^{\infty} d...
Let $W$ be a standard Brownian motion, $a>1$, and $\tau$ the stopping time $\tau=\inf \left\{t: e^{W_{t}-t / 2}>a ight\}$. Prove that, $\forall \lambda \geq 1 / 2$,...
Visit the FBIs web site and review a posting entitled Common Fraud Schemes. Select one of the fraud schemes and prepare a slide presentation for the class. This presentation should explain how the...
suppose a nickel-contaminated soil 15 cm deep contained 800 mg/kg Ni, Vegetation was planted to remove the nickel by phytoremediation. The above-ground plant parts average 1% Ni on a dry-weight bas...
Predict the effect on protein structure and function of an AT to GC transition in the first codon position for lysine?
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
Describe how nucleotide substitutions at different positions in codons affect the characteristics of the encoded amino acids?
Packer, Inc., a U.S. producer of computer disks, plans to establish a subsidiary in Mexico in order to penetrate the Mexican market. Packer's executives believe that the Mexican peso's value is...
In Ricart-Agrawal's mutual exclusion algorithm, when a process finishes its CS (critical section) execution, it sends a "Reply" message to all queued processes. Consider the following figure, where...
(a) Write down the "marker sending rule" and "marker receiving rule" of the Chandy- Lamport's Global Snapshot algorithm. [6] (b) For the given scenario, a marker is sent out as shown. [6] Marker sent...

Describe the intra-and intermolecular bonds or interactions that are broken or retained when collagen is heated to

Question:

Step by Step Answer:

When collagen is heated to produce gelatin several intra and intermolecular bonds or interactions are broken or retained in the process Collagen is a ...View the full answer

Fundamentals Of Biochemistry Life At The Molecular Level

Students also viewed these Sciences questions