2. (3 points) DNA strings are constructed from the alphabet (A, C, G, Ti, whose symbols represent the bases adenine, cytosine, guanine, and thymine. As an example, "AAGATGCCGT" is a DNA string of length 10. Given two strings s and t, t is a substring of s if t is contained as a contiguous collection of symbols in s (as a result, t must be no longer than s). The position of a symbol in a string is the total number of symbols found to its left, including itself (e.g., the positions of all occurrences of 'U' in "AUGCUUCAGAAAGGUCUUACG" are 2, 5, 6, 15, 17, and 18). The symbol at position i of s is denoted by sli]. A substring of s can be represented as slj:k] where j and k represent the starting and ending positions of the substring in s; For example, if s "AUGCUUCAGAAAGGUCUUACG", then s[2:5]"UGCU". The location of a substring slj:k] is its beginning position j; note that t will have multiple locations in s if it occurs more than once as a substring of s. Check Sample here: Given: Two DNA strings s and t (each of length at most 1000). Return: All locations of t as a substring of s