3. Assignment Tasks 3.1 Longest Common Substring Consider the Longest Common Substring (LCS) problem studied in the course 1. Recall the recursive formula for the optimal sub-problem of the LCS solution. (1pt) 2. Write a code that finds the LCS between two arbitrary strings by using Dynamic Programming 3. Consider the following two strings: strl "ARSDCSFOGMLKMIUOONP" and Str2 (1pt) GHCLPPOEWMHGFMDSOXZN". Report the result of LCS code applied on these two strings (provide both the LCS and its length) (1pt) 3.2 Longest Palindrome Substring Consider the following DNA sequence: AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAG TGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTG ACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAA 1. Explain how to use a code for LCS to find the longest palindrome of any sequence. (1pt) our previous LCS 2. Provide the code that implements your solution. This code should use y code as a function (Ipt) 3. If we consider the above DNA sequence as a text sequence, report the output of your palindrome code applied on this sequence (provide both the Palindrome Substring and its (1pt) length). 3.3 Longest Nucleotide Palindromic Subsequence 1. Explain how to use a code for LCS to find the longest nucleotide palindromic subsequence of any DNA sequence Provide the code that implements your solution. This code should use your previous LCS code as a function. Report the output of your palindrome code applied on the above DNA sequence (provide both the Palindromic Subsequence and its length). (1pt) 2. (1pt) 3. (1pt)