Question: 8. Suppose we are interested in studying a DNA sequence which consists of four bases: A, c, G, and T. For example: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA. Your goal

8. Suppose we are interested in studying a DNA sequence which consists of four bases: A, c, G, and T. For example: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA. Your goal is to compute the occurrence (expressed as a percentage) of each base and output it in the following format (including the header): Base Statistics A: 36.0 T: 20.0 G: 16.0 C: 28.0 Constraints: The DNA sequence can be from 1 to 50 characters long. In order to output floating point numbers with only one decinal digit, you nay use "s.11f . You must read the DNA sequence input from the user

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

IN C++ PLEASE Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G, and T. For example TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA. Your goal is to...

in java please 5. Suppose we are interested in studying a DNA sequence which consists of four bases: A,C,G, and T. For example: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA. (a) Write a...

5. Test Scores. Write Test a program that stores a set of random test grades and produces the following output. your program several times with a class which has a low, medium, and high variance of...

I need this done in java code please ill rate fast 5. Suppose we are interested in studying a DNA sequence which consists of four bases: A,C,G, and T. For example:...

GENETICS AND FORCES OF EVOLUTION Introduction The goal of anthropological genetics is to understand the evolutionary relationships, demographic histories, and genetic bases of biological variation in...

WRITE THIS PROGRAM IN JAVA (INCLUDE COMMENTS FOR EVERY LINE OF CODE) Introduction DNA, or deoxyribonucleic acid, is a set of large molecules that make up our genetic blueprint. They are located in...

CODE THIS PROGRAM IN JAVA!!! Introduction DNA, or deoxyribonucleic acid, is a set of large molecules that make up our genetic blueprint. They are located in each of our cells, packaged as...

WRITE THIS PROGRAM IN JAVA (INCLUDE COMMENTS FOR EVERY LINE OF CODE) Introduction DNA, or deoxyribonucleic acid, is a set of large molecules that make up our genetic blueprint. They are located in...

Exercises Chapter 2 2.1 Marginal and conditional probability: The social mobility data from Section 2.5 gives a joint probability distribution on (Y1 , Y2 )= (father's occupation, son's occupation)....

1 2.3 Definition of a Discrete Probability Function Definition: Let S be a discrete sample space from some experiment. A function P, defined on all events in S, is said to be a probability function...

A steam turbine is operating at a steady state with a mass flow rate of 5 kg/s and an inlet temperature of 300C. The outlet temperature is 100C and the specific enthalpy at the inlet is 3200 kJ/kg....

Harry considers to buy 1,000 bonds. The bond is semi-annual coupon bond with 10-year maturity, $1,000 par value bond with a 10 percent annual coupon, and 10 percent annual required rate of return?...

a bank is fucntuoninh ss which of th When a bank makes a loan to a business using funds which are provided to the bank by the bank's depositors, the bank is functioning as which of the following?...

Ali has a Sony A 7 RIV camera which he wants to sell. On 1 January 2 0 2 4 , he put an advertisement in the Facebook Marketplace. The price quoted there was RM 1 0 , 0 0 0 . In that advertisement, he...

3. Outline the four major approaches to informative speeches

4. Employ strategies to make your audience hungry for information

2. List and describe each of the eight categories of informative speeches