Question: A basketball player throws a ball with an average horizontal force of 8 0 N and his hand and the ball move through a horizontal

A basketball player throws a ball with an average horizontal force of 80 N and his hand
and the ball move through a horizontal displacement of 5.7 m during this period of force
application. The ball is 0.35kg and the initial horizontal velocity is zero at the start. How fast
would the ball be going at the end of the delivery phase when the player released it?

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

A great problem Lets break it down The player applies a force of 80 N horizontally and the ball move... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Physics Questions!

Q:

CANMNMM January of this year. (a) Each item will be held in a record. Describe all the data structures that must refer to these records to implement the required functionality. Describe all the...

Q:

ENSURE WORK IS ORIGINAL OR I REJECT AND REPORT YOU TON THE SUPPORT INSTANTLYThe end result does now not should be taken care of. You may additionally expect n 6 length(xs). [Hint: Function least is a...

Q:

Planning is one of the most important management functions in any business. A front office managers first step in planning should involve determine the departments goals. Planning also includes...

Q:

Please answer ALL questions as this is very important. 1. A ball is thrown straight down from a building. As it falls, there is an increase in its: a. velocity, momentum, and potential energy. b....

Q:

Question 7 - 15 marks You should be able to answer this question after studying Unit 10. A basketball player throws a basketball at an angle of 65 to the horizontal and at a speed of 5 ms . The...

Q:

Can I have detailed answers to question 9-27 I don't really understand CHAPTER 2 REVIEW Knowledge 8. (2.4) For an object thrown vertically upward. 1. (2.2) During the Terry Fox Run, a participant...

Q:

Problem 4: A child of mass m = 24 kg slides down a slide of height h = 2.5 m without friction. Let gravitational potential energy be zero at ground level. Part (a) Write an expression for the child's...

Q:

Question 1 of 20 > 1 I U'l l : View Policies Current Attempt in Progress Just after a motorcycle rides off the end of a ramp and launches into the air, its engine is turning counterclockwise at 7020...

Q:

Question 8 (2 points) A 0.144 kg baseball is pitched horizontally at +38 m/s. It is in contact with a bat for 8.0 x 10-4 s and then travels at -38 m/s. The impulse the bat delivered to the ball is -_...

Q:

Please provide corrections and advice if on how to do these problems. HNES 368 Practice Problems for Chapter 4 These practice problems are due by Tuesday (3/29/22). You must show your work to receive...

Q:

1. You own a call option with a strike price of $27.50.What is your payoff on this option contract if the underlying stockis selling for $31.20 on the option expiration date? The payoff amount is the...

Q:

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...

Q:

Required information [The following information applies to the questions displayed below.] RayLok Incorporated has invented a secret process to improve light intensity and, as a result, manufactures...

Q:

In August 2015, a customer at TU Bank slipped on a wet floor and broke an arm. The customer sued the bank in September 2015. As of TU Banks December 31 year- end, the companys attorneys believe that...

Q:

The Fitness Studio, Inc., with the help of its investment bank, recently issued $43.125 million of new debt. The offer price (and face value) on the debt was $1,000 per bond and the underwriters...

Q:

Vallot was driving his farm tractor on the highway. It was struck from the rear by a truck, overturned, exploded, and burned. Vallot was killed, and a death claim was made against All American...

Q:

Dons Captain Morgan, Inc. needs to raise $12.5 million to finance plant expansion. In discussions with its investment bank, Dons learns that the bankers recommend an offer price (or gross proceeds)...

Q:

Amador Pena, who had three insurance policies on his life, wrote a will in which he specified that the proceeds from the insurance policies should go to his children instead of to Leticia Pena...

Q:

A shaft carries five masses A, B, C, D and E which revolve at the same radius in planes which are equidistant from one another. The magnitude of the masses in planes A, C and D are 50 kg, 40 kg and...

Q:

A runner, jogging along a straight line path, starts at a position 60 m east of a milestone marker and heads west. After a short time interval he is20 m west of the mile marker. Choose east to be the...

Q:

A merry-go-round (radius R, rotational inertia Ii) spins with negligible friction. Its initial angular velocity is (i. A child (mass m) on the merry-go-round moves from the center out to the rim. (a)...

Q:

A source and receiver of EM waves move relative to one another at velocity v. Let v be positive if the receiver and source are moving apart from one another. The source emits an EM wave at frequency...

Q:

10. Rugby Injuries The prevalence and patterns of knee injuries among women collegiate rugby players were investigated using a sample questionnaire, to which 42 rugby clubs responded.19 A total of 76...

Q:

12. Catching a Cold Is your chance of getting a cold influenced by the number of social contacts you have? One study seems to show that the more social relationships you have, the less susceptible...

Q:

11. Favorite Fast Foods Is a customers preference for a fast-food chain affected by the age of the customer? If so, advertising might need to target a particular age group. Suppose a random sample of...