a). In one of the recent presentations we discussed FASBs deliberation on where the non controlling interest

Fantastic news! We've Found the answer you've been seeking!

Question:

a). In one of the recent presentations we discussed FASB’s deliberation on where the non controlling interest should appear on a consolidated balance sheet?

b). What were the alternatives FASB considered and what was their ultimate choice?

c). Do you agree with the choice? Why or why not?

Related Book For answer-question

A Pathway to Introductory Statistics

ISBN: 978-0134310039

1st edition

Authors: Jay Lehmann

See More Books

Posted Date: Nov 05, 2020 09:45 PM

See More Questions

Cutlery Corner sells specialty knives to knife enthusiasts. They have a generous advertising budget to spread among four media channels: their recurring TV show, newspaper ads, radio spots, and...
Do you agree with Hofstede's findings about U.S. culture? Other cultures? On what do you base your agreement or disagreement?
Do you agree with Kohn or Cummings? Are there situations in which the opposing position would ever apply? What does the latest research indicate regarding this question? Think of a real-life example...
Consider a post office with two employees and a single waiting line. On average, the inter-arrival time is 6 minutes. Standard deviation of inter-arrival time is 3.94 minutes. Average service time is...
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
An igneous rock can be transformed into a metamorphic rock by (a) weathering, erosion, deposition, then compaction to become a sedimentary rock, then heat and pressure. (b) being squeezed by great...
Use computer software to work Exercise 12.37. Data From Exercise 12.37 12.37 An experimenter wants to compare the time to failure y after rebuilding a robotic welder by three different methods but...
1. How fair is it for the recruiters described here to reject candidates because they display poor manners, such as receiving e-mail messages during the job interviews? 2. Of what significance is it...
(a) Apply your linear regression model using gradient descent to find the best fit of the data given by: x = np.array([ 0., 1.66666667, 3.33333333, 5.0, 6.66666667, 8.33333333, 10.0, 11.66666667,...
Comparative financial statement data of Stow Optical Mart follow: Other information: 1. Market price of Stow Optical Mart common stock: $122.91 at December 31, 2018, and $165.75 at December 31, 2017...
(Adapted from Catherine et al. 2020 and Sabelhaus and Volz 2020) Suppose that you are earning the salary of a median household in Manhattan ($51,000) and you just turned the age of 22. You intend to...
Explain the ethical dimensions associated with any health communication program.
Compare and contrast the effects of low health literacy and high health literacy.
Describe an activity that might be used to incorporate the three types of brain breaks discussed in the chapter. For each example, discuss a possible positive and negative outcome of incorporating...
What are the tones used in television advertising? Define each.
Define repositioning and explain under what circumstances a brand might be repositioned.
How do mutualistic interactions between species influence patterns of dispersal, gene flow, and speciation, and what are the evolutionary consequences of these interactions for the diversification...
Baxter, Inc., owns 90 percent of Wisconsin, Inc., and 20 percent of Cleveland Company. Wisconsin, in turn, holds 60 percent of Clevelands outstanding stock. No excess amortization resulted from these...
(10, 329) and (30, 26) Find an approximate equation y = abx of the exponential curve that contains the given pair of points. Round the values of a and b to two decimal places.
-5 + 0.2 Find the sum by hand.
Although the United States and Great Britain use the Fahrenheit (F) temperature scale, most countries use the Celsius (C) scale. The temperature reading 0C is equivalent to the Fahrenheit reading...
Harry wants to contribute either $$6,500$ (BT$$)$ to a traditional deductible IRA or $$6,500$ (AT$$)$ to a Roth IRA. His current tax rate is 30% for ordinary income and 15% for capital gains....
The XYZ Partnership reports the following items during 2022: Calculate ordinary income (or loss) by completing page 1 of Form 1065, and complete Schedule K (Partners Shares of Income, Credits,...
Rita, a calendar year taxpayer, is an employee of the RST Partnership, which has a June 30 year-end. The partnership pays Rita a salary of 2,500 per month for the period January 1 through June 30,...

a). In one of the recent presentations we discussed FASBs deliberation on where the non controlling interest

Question:

Expert Answer:

Noncontrolling interest or minority interest state of affairs takes place whilst an company does now no longer personal one hundred of a subsidiary ... View the full answer

A Pathway to Introductory Statistics

Students also viewed these accounting questions