Question: A research lab requires an application to go through thousands of DNA samples and find all the matches to their sample. A DNA strand representation
A research lab requires an application to go through thousands of DNA samples and find all the matches to their sample.
A DNA strand representation is done through combinations of the characters 'a', 'c', 'g' and 't' with no spaces in between. These combinations are kept as a cString of characters in a comma-separated file with a 6 digit integer id attached to each sample as follows:
243245,acccgttcgattcagtcgatcgatcgggatattgcaaa
Each DNA strand is between 100 to 1000 characters.
The number of DNA strands in the data file could be millions. This amount is different in each data file.
Your responsibility is to write a library of functions in a module called "DNA" that can support the main program provided to have the following execution outcome:
The ids in the file are not sorted. Your search results must be sorted based on the Ids of the DNA strands in ascending order:
Enter DNA data file name: lowBaseDnaSmall.csv DNA search program Enter a DNA squence (max 100 chars) > gtcc 4 matches found: 1) 444136: atattttccactgaacggtccagatcgacgatcggggtgtaacagttcatctttggtataccctctccggcgttagatatggtcgaaacgggaacggctag ====================================================================== 2) 448885: ctgatgcagatggattgcgataacggagcgcaatgtgcaatacgggccttcgggaaacggctcgtccgtttcccgaacgcggaacgcaaagaacatgaca ====================================================================== 3) 469926: cggaccacggcccccgtcccccgcatgttcgacgagtggatagagttgagatccatccctttcctagcgtcattgttgcgatacgattgtagtgagcagct ====================================================================== 4) 489349: ccccttttaccaaatcgaagcttttgtgcgaatgtggtcttattgtacgtccgtctcacaggtgactcacactgtccgctctactgagaagcctcctatgc ====================================================================== Enter a DNA squence (max 100 chars) > gtacct No match found! Enter a DNA squence (max 100 chars) > ! DNA Search Program Closed.
Functions
bool beginSearch(const char *filename);
It will try to open the file and initialize any requirements needed for the application. Returns true if the file is opened successfully and returns false it fails to open the file.
bool read(const char* subDNA);
Dynamically creates an array of DNA records to the number of matches found in the file and stores the matches in them. Returns true if at least one match is found and false if no match is found in the records.
void sort()
Sorts the dynamic array of DNA matches found in the file based on the ids in ascending order.
void displayMatches()
Displays the dynamic DNA records in the following format.
row) ID: DNA strand ======================================================================
void deallocate()
Deallocates all the dynamic memory within the DNA array elements and the DNA array itself.
void endSearch()
Finalizes the program by releasing the resources allocated by the program (like closing the data file and etc...).
And then Prints:
DNA Search Program Closed
Step by Step Solution
There are 3 Steps involved in it
Get step-by-step solutions from verified subject matter experts
