Question: Can you please explain this to me if its correct how b ) Given the DNA sequence; GCT GGT TTC CCA What is the

Can you please explain this to me if its correct how "b) Given the DNA sequence;
GCT GGT TTC CCA
What is the order of amino acids? _________
Arginine, Glycine, Lysine, Proline [1 mark] thank you

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

Please read the instructions carefully. A new client of yours, Katie Perez wants to open an ice cream shop near the downtown shopping center. She will selling Frozen POPS, Frozen Ices, Frozen POPS...

Q:

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Q:

You have a cDNA, part of the sequence of which is reproduced in Figure 3. You want to insert the portion encoding the highlighted region (WW3) into an expression vector, pAcGFP1 (Fig. 4) to produce a...

Q:

Write a reference class called DNASequence. This will contain the name of a species (as a string) and a sequence of DNA nucleotides, also called bases. There are four kinds of bases: adenine (A),...

Q:

help me please 4 Multiple Choice 1 point Prion proteins O A single mutation in a gene in a somatic cell for a prion protein can cause that protein to induce misfolding in other prion proteins Prion...

Q:

Write the data processing methods, such as codon() and codon2aa() in a separate Java class, and the input and output in another class. (include comments) 1. Develop a Java program to read in a piece...

Q:

Part A Nucleotides have three parts: a phosphate group, a sugar, and a base. Label those parts in the nucleotide shown here. Drag each label to the appropriate target. View Available Hint(s) Reset...

Q:

in python please see the requirement clear answer. you can copy the table...... # Triples and their three-letter abbreviations # 'TTT': 'Phe', 'TCT': 'Ser', 'TGT': 'Cys', 'TAT': 'Tyr', 'TTC': 'Phe',...

Q:

Create a Java program called NumberStats that reads data from a file containing, on each line, the name of a species of mammal, a tab character, and a sequence of letters representing the nucleotides...

Q:

JAVA Use this test file to test the program! Assignment Txt file to test the program dna.txt to test your program: Rodentia...

Q:

JAVA Use txt file below to test the program. txt file to test the program: Ailuropoda melanoleuca...

Q:

You need to set an 8-digit PIN. There is a hexadecimal keypad (0-9, A-F), but there are some restrictions on the PIN you can choose. You can re-use digits but you cannot have repeating digits next...

Q:

1. Why did Subaru partner with Toyota? 2.Who are Starbucks, McDonald's, Coca-Cola, LEGO target customers? Why? 3.What are Tesla's pricing and marketing strategies? 4.How is US China politics...

Q:

Question 5 Partner A has a smaller capital balance than Partner L . Partner A however, has a higher profit - and - loss - sharing percentage than Partner L . The LA partnership has decided to...

Q:

On pages 168-170 of Language Shock, Agar discusses an unusual form of social research named after the sociologist Harold Garfinkel. In order to make evident the background social understandings we...