def rna2codon (rna): This function takes in a string representing an RNA sequence, and returns the corresponding amino acid string, as transcribed by this codon table. You do not need to transcribe the stop codon. (HINT: You already did this in Lab03, go open it up and figure out how to incorporate it here!) Example: Sample RNA string: "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA" The returned protein string: "MAMAPRTEINSTRING" RNA codon table A table indicating the translation of individual RNA codons into amino acids for the purpose of protein creation CUU L CUC L CUAL GUU V GUC V GUA V GUG V GCU A GCC A GCA A GCG A UUU F UUC F UUAL UUGL UCU S UCC S UCA S UCG S UAU Y UACY UAA Stop UAG Stop UGU C UGC C UGA stop UGG W CUG L CCU P CCCP CCA P CCG P CAU H CACH CAAQ CAGO CGUR CGC R CGA R CGGR AUU I AUC I AUA I AUGM ACUT ACAT ACGT AAUN AAC N AAA K AAG K AGUS AGCS AGAR AGGR GAU D GAC D GAA E GAG E GGU G GGC G GGA G GGGG