Question: def splice_rna(dna, intron_list): This function takes in a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA

 def splice_rna(dna, intron_list): This function takes in a string representing a
DNA sequence and a list of strings representing introns. The process of

def splice_rna(dna, intron_list): This function takes in a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string splice_rna() should return a protein string that results from transcribing and translating the exons of the given string. (HINT: You should use some of your previous functions. It's similar to the last part of Labo3) Example: Sample input DNA string: "ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATOGGTCGA GCGTGTTTCAAAGTTTGCGCCTAG" I Sample intron list: ["ATCGGTCGAA", "ATCGGTCGAGCGTGT") The returned protein string: "MVYIADKQHVASREAYGHMFKVCA

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!