Question: DESIGNING PRIMER EXTENSIONS Based on this, give the extensions (the sequence of additional bases) that must precede the annealing region of each of your primers

DESIGNING PRIMER EXTENSIONS Based on this, give the extensions (the sequence of additional bases) that must precede the annealing region of each of your primers determined in the previous section. Extension Annealing region (from section 1) Full primer Primer 1 (5' end) ATGGCCATGCCTTCCTCTTC Primer 2 (3' end) CTAGGCAACTGGTTGGAAGA

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Mathematics Questions!

X Flat Available For Rent Civic Cen + S76 View Robinhood Extensions PROJECT Selection Control with Java - Differential Piecework Schedule Obiective To construct a program that demonstrates selection...

Answer assessment questions MBA NSW RTO #6163 31 Below Ground and Remedial Waterproofing Workshop 27. Select from the list below using the manufacturer's Technical Data Sheet (TDS) the appropriate...

DESICHING PRIMER EXTENSIONS lech of your primers Based on this pu the Annualing region 20 ANGGOCATGOUTTOLICITE il il CLAGGCAACTGGTIOGAAGA

Unit 2: Designing the Operations Designing the operations of an organization or your department - precedes operational management. For .ll _ . example, suppose a wallet manufacture's mission is to '...

Define primer. What are parameters to take account while designing primer for amplification?

Briefly explain which of the following knowledge types will be applicable for each of the situations listed below.( Give reason) (FOR EACH SECTION 1-5, CHOOSE THE KNOWLEDGE TYPE a-e ,AND WRITE THE...

Please critically analyse and respond the question clearly, don't just give point, gives details, your answer must be reliable, justify gives example also gives citations and references! ALSO PLEASE...

Alison Why does a divisional structure make it difficult for us to share solutions? The divisional structure has redundancies that create more work for your managers, so they don't have time to...

ans Joelle How would we redefine this technology in general terms? Each product listed can be considered its own line with additional extensions coming from that product as well. The patents could be...

PROJECT 20\% - For this assignment you have to design an event. Could be any event you will like. - You will be the event planner and you have to organize the event following all the steps from the...

Deacon, Raines, and Francis arranged to import and sell orchid corsages for a university dance. They agreed to share equally the net income or net loss of the venture. Deacon and Raines advanced $300...

Review the sample transitional matrix shown in Table. What jobs experience the greatest turnover (employees leaving the organization)? How might an organization with this combination of jobs reduce...

Tax Determinations Tax Determinations a type of Ruling regarding a very specific point of tax law. They have the same status as Public Rulings. However, Tax Determinations are intended to be short...

4. Which rule in The Bluebook addresses citation for journals, magazines, and newspaper articles for academic writing? 5. In what section of The Bluebook are instructions for using " Id. "? 6. W