Question: Given : A DNA string of length at most 1 kbp in FASTA format. Return : The position and length of every reverse palindrome in

Given: A DNA string of length at most 1 kbp in FASTA format.

Return: The position and length of every reverse palindrome in the string having length between 4 and 12. You may return these pairs in any order.

EXAMPLE: Sample Dataset: >Rosalind_24 TCAATGCATGCGGGTCTATATGCAT

Sample Output: 4 6 5 4 6 6 7 4 17 4 18 4 20 6 21 4

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

yea public class Node String name; String val; // The value of the Node String abbrev; // The abbreviation for the Node ArrayList outgoingEdges; ArrayList incomingEdges; public Node ( String...

[The code is supposed to get 90 points when you run the test code. If your code get 90 points, I promise I WILL give you thumb up rating. Help me please] for a few kinds of cancer. Every minute,...

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

the required functions are at the end for easy use. These are the functions required that I have coded. I am lost on how to contribute them into these new functions. Once the new functions are coded...

in python language Problem The GC-content of a DNA string is given by the percentage of symbols in the string that are 'C' or 'G'. For example, the GC-content of AGCTATAG' is 37.5%. Note that the...

in python Problem The GC content of a DNA string is given by the percentage of symbols in the string that are 'C' or 'G' For example, the OC content of AGCTATAGS 375% Note that the reverse compartent...

Python 3 def # Given a DNA sequence in string object, this function will not return anything, but it will # print out the 6 frame translation results (eg, 6 proteins sequences). In this function #...

Open Reading Frames - Rosalind Problem Either strand of a DNA double helix can serve as the coding strand for RNA transcription. Hence, a given DNA string implies six total reading frames, or ways in...

Prompt: Given the genomic sequences for an organism; one of the first steps in identifying the genes is to identify the open reading frames (ORFs). An open reading frame is a maximal length sequence...

def detect enzmelseg, enzxme dict: # Given a DNA sequence in string object and a dictionary that contains enzyme name # (key) and sequence (value), this function will not return anything, but it will...

Which compound, upon treatment with sodium hydride, would form a cyclic ether more rapidly? a. b. c. HO Br or HO HO Br

You have to design a network between 7 cities, (A thru F are arranged forming an hexagon and the seventh "G" is the center). Consider carefully the design restrictions because you have a limited...

uppose the quote for a five - year swap with semiannual payments is 8 . 5 0 8 . 6 0 percent. This means Multiple Choice the swap bank will pay semiannual fixed - rate dollar payments of 8 . 5 0...

5. Develop a scenario comparing two PH programs and involving the use of a CBA.

2-4 What is the role of the information systems function in a business? Describe how the information systems function supports a business. Describe the services provided by information systems...

1 What are business processes? How are they related to information systems? Define business processes and describe the role they play in organizations. Explain how information technology and...

2-3 Why are systems for collaboration and social business so important and what technologies do they use? Define collaboration and social business, and explain why they have become so important in...