Question: Given a scoring scheme Match =2, Mismatch =1, Indel ', find the alobal aliznment score-matrix optimal alighment-score, and the optimal global alement of the sequences

Given a scoring scheme "Match =2, Mismatch =1, Indel ', find the alobal aliznment score-matrix optimal alighment-score, and the optimal global alement of the sequences "TCACA6" and "TGAACG". Implement the solution uning the Needleman-Wursch algorithm. in case, there evist multiple solutions with an optimal score, you reed to show acy one of them

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Lab Exercise - Practical 8 - part 1 By using a manually generated dot plot, align the provided sequences and calculate their scores accordingly: a ) Sequence A: TCAACTGAGTTCTGTTTAATG Sequence B:...

Fill out the following matrix according to the Needleman - Wunsch algorithm, using the following scoring scheme: match = + 2 , mismatch = - 1 , gap = - 4 Trace the alignment path through the matrix...

3. (4 points): Individual assignment Consider global alignment with affine gap penalty function. Let the scoring scheme parameters be as follows: match score (m) = +1; mismatch penalty (m) = -2; gap...

Please help me with this rcode question, thank you Problem 4 [R - 24 points. In this problem, you will investigate via simulation the effect that two scoring systems have on eliminating bias in...

these all photos are a single assignment question. please solve according to the rubric given at the bottom. fondet Aduced the Protection and has detected any Meats it you need to edit this to click...

ONLY NEED #4 PLEASE 12 4 14 12 9 4 Darts, like any game of skill, involves some degree of randomness. In this project, we will try to analyze the chances 5 20 1 18 of earning various point totals in...

Chapter Project Darts and the Normal Distribution 5 12 5 20 7 12 Darts, like any game of skill, involves some degree of randomness. In this project, we will try to analyze the chances 18 of earning...

PROGRAM ON NEGOTIATION AT HARVARD LAW SCHOOL AN INTER-UNIVERSITY CONSORTIUM TO IMPROVE THE THEORY AND PRACTICE OF CONFLICT RESOLUTION HARBORCO DRRC Version* General Information and Confidential...

Use the Star alignment algorithm to compute a multiple sequence alignment ( MSA ) for the sequences: Sequence 1 : AGTCCT Sequence 2 : ACTGTTC Sequence 3 : CCGCGTT Sequence 4 : GGGTCCT The scoring...

For NDS, quality customer service is a top priority. When a small business contacts the call centre for a service request, it is important that customer service meets or exceeds the request. That...

On January 1, Year 1, Milton Manufacturing Company purchased equipment with a list price of $25,000. A total of $1,600 was paid for installation and testing. During the first year, Milton paid $2,400...

Why might a home country intervene in foreign direct investment?

Approximately _ _ _ _ percent of all credit reports have one or more problems. 4 0 3 0 2 0 1 0

5. Develop a scenario comparing two PH programs and involving the use of a CBA.

(Appendices) How is this affected by business policies concerning prices and credit sales? LO2

(Appendices) Compare the Original Medicare Plan with Medicare Advantage Plans with respect to each of the following: LO5 a. Choice of plan coverage b. Benefits provided by the plan c. Need for a...

(Appendices) Forrest, age 23, was honorably discharged from the U.S. Marine Corps after four years, which included two tours of duty in Iraq. He was severely wounded when his platoon engaged in a...