Question: i need help solving this problem please! Exercise 12-12 (Part Level Submission) On July 1, 2017, Marigold Corporation purchased Young Company by paying $256,600 cash

On July 1, 2017, Marigold Corporation purchased Young Company by paying $256,600 i need help solving this problem please!

Exercise 12-12 (Part Level Submission) On July 1, 2017, Marigold Corporation purchased Young Company by paying $256,600 cash and issuing a $115,000 note payable to Steve Young. At July 1, 2017, the balance sheet of Young Company was as follows. $50,200 Accounts payable $208,000 Cash Accounts receivable 90,000 Stockholders' equity 237,900 $445,900 106,000 Inventory Land 41,300 Buildings (net) 75,900 Equipment (net) 70,500 Trademarks 12,000 $445,900 The recorded amounts a approximate current values except for land (fair value of $61,400) inventory (fair value of $125,800), and trademarks (fair value of $16,160

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Accounting Questions!

Exercise 12-12 (Part Level Submission) On July 1, 2017, Sheffield Corporation purchased Young Company by paying $260,600 cash and issuing a $105,000 note payable to Steve Young. At July 1, 2017, the...

Brief Exercise 10-8 Marigold Corporation traded a used truck (cost $24,400, accumulated depreciation $21,960) for a small computer with a fair value of $4,026. Marigold also paid $610 in the...

Exercise 12-10 (Part Level Submission) Skysong Industries has the following patents on its December 31, 2016, balance sheet. Patent Item Initial Cost Date Acquired Useful Life at Date Acquired Patent...

Prepare the July 1 entry for Cheyenne Corporation to record the purchase. (Credit account titles are automatically indented when amount is entered. Do not indent manually. If no entry is required,...

Exercise 12-12 (Part Level Submission) On July 1, 2017, Pronghorn Corporation purchased Young Company by paying $260,600 cash and issuing a $146,000 note payable to Steve Young. At July 1, 2017, the...

Brief Exercise 12-3 Splish Brothers, Inc., spent $71,100 in attorney fees while developing the trade name of its new product, the Mean Bean Machine. Prepare the journal entries to record the $71,100...

Exercise 12-12 (Part Level Submission) On July 1, 2017, Blue Corporation purchased Young Company by paying $258,200 cash and issuing a $146,000 note payable to Steve Young. At July 1, 2017, the...

Exercise 12-12 (Part Level Submission) On July 1, 2020, Ayayai Corporation purchased Young Company by paying $257,800 cash and issuing a $139,000 note payable to Steve Young. At July 1, 2020, the...

Check if the answers on the Third image are correct. Make any adjustments ONLY IF necessary. (a) Cash .................................................................. 15,000 ...... Accounts...

Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU

What is financial statement fraud? Identify several characteristics of companies that have been involved in financial statement fraud that have been identified in the published enforcement actions of...

We have a computer that stores binary signed integers in two s complement form. All numbers are 8 bits long. ( 1 0 pts ) a . What decimal number is represented by 0 1 1 0 1 0 1 1 ?

Which of the following are problems with identifying users of ABC? Multiple select question. ABC means different things to different organizations. Organizations will announce the discontinuance of...

8. Demonstrate aspects of assessing group performance

3. Create a chart that lists the four leadership styles described in this chapter (directive, participative, supportive, and achievement oriented). Evaluate the leaders of each of the different...

1. LaunchPad for Real Communication offers key term videos and encourages selfassessment through adaptive quizzing. Go to bedfordstmartins.com/realcomm to get access to: LearningCurve Adaptive...