Question: In E. coli , the Tus protein terminates DNAreplication by directly blocking the activity of the enzyme Multiple Choice helicase. DNA pol III. primase. topoisomerase.

In E. coli, the Tus protein terminates DNAreplication by directly blocking the activity of the enzyme

Multiple Choice

helicase.

DNA pol III.

primase.

topoisomerase.

DNA pol I.

Step by Step Solution

★★★★★

3.45 Rating (155 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

Answer and step by step explanation Answer DNA pol III The Tus protein is a protei... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

The 3-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between correctly and incorrectly base-paired nucleotides at the 3 -terminus; properly and improperly...

Q:

Multiple Choice 1. Real estate sales are recognized by the accrual method if all of the conditions defined by FASB Statement No. 66 are met. Which of the following is not one of the conditions...

Q:

Multiple Choice Questions 1. The information provided by financial reporting pertains to: a. Individual companies, rather than to industries or the economy as a whole or to members of society as...

Q:

The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3

Q:

A - false 1 . 2 . 1 . Which of the following statements are correct for the production of human insulin in E . colit? Insulin is a complex protein undergoing glycosylation. E . coll is chosen as host...

Q:

For each E . coli genotype below, indicate whether high levels of beta - galactosidase ( Lacz ) activity will be produced when grown in lactose or glycerol. crp represents the gene for cyclic AMP...

Q:

fitness chain agrees to partner with a manufacturer of protein powders by including a small ad on its website. Every time a customer clicks on this ad , e manufacturer pays the fitness chain a set...

Q:

A patient develops a blood infection with capsule - producing strain of E . coli. Which of the following will be directly required to allow opsonization of the encapsulated E . coli: A . release of...

Q:

For each scenario described below, state whether or not the binomial distribution is a reasonable model for the random variable and why. State any assumptions you make. (a) A production process...

Q:

Which of the following should be included in the cash flow projections for a new product? I. Money already spent for research and development of the new product II. Capital expenditures for equipment...

Q:

Identify at least four typical cost pools for activity-based costing in most organizations.

Q:

Gemma Lopez, a businessman has P300,000 in his personal savings account. He transferred half of this to the account of NG MAINTENANCE SERVICES as initial investment? The business purchased cleaning...

Q:

1 1 ABC is a Medicare Advantage ( MA ) plan sponsor. It would like to use its enrollees' information to market non - health related products such as life insurance and annuities. Which statement best...

Q:

Suppose the government institutes a new sales tax on shoes, which are provided by a competitive constant-cost industry. a. Does the price of shoes change by more in the short run or in the long run?...

Q:

The fiscal year of Duchess County ends on December 31. Property taxes are due March 31 of the year in which they are levied. 1. Prepare journal entries (excluding budgetary and closing entries) to...

Q:

1. What is the basic natural law assumption that guides Steffens discussion of the death penalty? 2. Why does Steffen view the death penalty as an exception and where does Steffen place the burden of...

Q:

The T. L. Lin Company manufactures a variety of natural fabrics for the clothing industry in a suburb of Shanghai. The following data in Chinese currency called yuan pertain to the month of October....

Q:

SaveToday is a national discount retail store chain with annual revenues of more than $1 billion. Its a typical bricks-and-mortar operation with accounting software that records sales transactions in...

Q:

solve this Select the true statement about RAM. O a.) More RAM means a slower computer. O b.) It is slower than the hard disk. O c.) It is used for long-term storage. d.) It is volatile. O )

Q:

How would a lower p50 affect hemoglobin's oxygen acquisition in the lungs and oxygen delivery to the peripheral tissues?

Q:

Adipocytes store fat in phospholipid-coated droplets in the cytosol. The protein perilipin is also associated with the surface of the lipid droplet. (a) Describe the likely structure of the perilipin...

Q:

Certain E. coli bacteriophages encode a protein called Q, which binds to RNAP shortly after transcription initiation, before 70 is released. Q increases the rate of transcription and renders RNAP...

Q:

Recently, the manager of the call center for a large Internet bank asked his staff to collect data on a random sample of the banks customers. Data on the following variables were collected and placed...

Q:

The National Park Service has started charging a user fee to park at selected trailheads and cross-country ski lots. Some users object to this fee, claiming they already pay taxes for these areas....

Q:

You have collected the following information on 15 different real estate investment trusts (REITs). Identify whether the data are cross-sectional or time-series. a. income distribution by region in...