Question: Please do not copy from other people, because I asked all of them. 1. An oligonucleotide (a short DNA or RNA) has the following sequence:

 Please do not copy from other people, because I asked allof them. 1. An oligonucleotide (a short DNA or RNA) has the

Please do not copy from other people, because I asked all of them.

1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (c) Calculate the Tm of 0.1 uM of the oligonucleotide in an aqueous buffer solution containing 100 mm NaCl and 2 mM MgCl2 @ pH 7.0 using the nearest neighbor method

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Chemical Engineering Questions!