Question: Please do not copy from other people, because I asked all of them. 1. An oligonucleotide (a short DNA or RNA) has the following sequence:


Please do not copy from other people, because I asked all of them.
1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (c) Calculate the Tm of 0.1 uM of the oligonucleotide in an aqueous buffer solution containing 100 mm NaCl and 2 mM MgCl2 @ pH 7.0 using the nearest neighbor method
Step by Step Solution
There are 3 Steps involved in it
Get step-by-step solutions from verified subject matter experts
