Question: PLEASE USE MATLAB. THANK YOU! 1. Write a function named longestword that is used to compare 3 words. It should return the word with the

PLEASE USE MATLAB. THANK YOU!

PLEASE USE MATLAB. THANK YOU! 1. Write a function named longestword that

1. Write a function named longestword that is used to compare 3 words. It should return the word with the most number of characters and the first in the list when they have the same length). Sample Output: >>>longestword("Heat", "Lakers","Warriors") Warriors

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

WITH INPUT FUNCTION 1. Write a function named longestword that is used to compare 3 words. It should return the word with the most number of characters (and the first in the list when they have the...

COMPUTER SCIENCE PROBLEM PYTHON Instructions: For this assignment, you will construct a single python file called a4.py, with several text-processing functions. You are free to use your own solutions...

Python Only Do all of the items below and submit one ZIP file containing all the solutions via Canvas. If you run into a problem, post to Canvas describing where you ran into trouble or email your...

Problem 1 This problem provides practice using a while True loop. Write a function named twoWords that gets and returns two words from a user. The first word is of a specified length, and the second...

***Python please: 1. Write a function named problem1 that accepts a list of integers as the argument. Then your function should remove all the odd numbers from the list and sort the remaining non-odd...

CS100 while/break/continue Homework Read Chapter 7 in the textbook. Read Section 4.4 of the Python tutorial. Problem 1 This problem provides practice using a while True loop. Write a function named...

Develop a set of functions to analyze tweeter data. Specifically, write a program to prompt the user to enter a tweeter string. The program should develop a set of functions for the following string...

please please please dont use ai and please include pseudocode so i can learn from it thank you REQUIREMENTS Create a folder named with your surname followed by 6 then then the word prep ( example...

Please use program C Thank you! Question 1: Pointers of Pointers Write a function, named "ptr_to_ptr", that returns an int and takes three arguments: An int called "a". A pointer to an int called...

Q1) A) B) Please write in C++ Write a program that asks for a string. Then, it populates the elements of an integer array to keep track of the counts of each character in the given string. To make it...

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Refer to the most recent financial statements and related disclosure notes of Walmart Stores, Inc. You can find these at the Walmart website, walmartstores.com, or by using Edgar at www.sec.gov....

calculate sales: Return on Equity: 26% Days Inventory Held (DIH): 23 Net Profit Margin: 3% Equity: $150,000 Debt: $150,000 Cost of Goods Sold: $20,000 Net Working Capital: $33,000

Seved Help 14 Wisconsin Snowmobile Corp. is considering a switch to level production Cost efficiencies would occur under level production, and aftertax costs would decline by $31,500, but inventory...

a. Do team members trust each other?

a. How will the leader be selected?

How does the team fit into the overall management structure of the organization, classroom, and so on?