Question: We often identify research opportunities through 'practice-based evidence'. In other words - we did it this way and it seemed to work - I wonder

We often identify research opportunities through 'practice-based evidence'. In other words - "we did it this way and it seemed to work - I wonder if there is anything to that?" In some instances - the impact of a decision is SO very obvious that additional research is simply not needed. There are many interventions that have been 'time tested' and no longer need to be 'formally' validated. Can anyone think of examples of this?

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related General Management Questions!

An online retailer wants to optimize its marketing portfolio budget to maximize its return on investment (ROI). The retailer has decided to allocate a AED 1,000,000 budget across three different...

Educating Managers from an Evidence-Based Perspective Author(s): Denise M. Rousseau and Sharon Mccarthy Source: Academy of Management Learning & Education, Vol. 6, No. 1 (Mar., 2007), pp. 84101...

MATHEMATICIANS RISE TO A CHALLENGE ne of the theorems we teach in eighth grade is a + b= *, where c is the length of the hypotenuse of a right triangle in Euclidean space, and a and b are the lengths...

This text was adapted by The Saylor Foundation under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License without attribution as requested by the work's original creator or licensee. 1...

TANGLEWOOD CASEBOOK for use with STAFFING ORGANIZATIONS 5th Ed. Kammeyer-Mueller 1 TANGLEWOOD CASEBOOK To accompany Staffing Organizations, fifth edition, 2006. Prepared by John Kammeyer-Mueller...

Management must understand what needs to change. A culture of performance excellence is very different from a traditional management culture. Many traditional practices stem from the fundamental...

We need a short summary on how was the project done. The summary is below: Google's Project Oxygen: Do Managers Matter? In November 2012, Prasad Setty, Google's vice president, people analytics and...

Management 587 Case/Assignment/Summary Activity Name Texas A&M-Commerce In partial fulfillment of the requirements for MGT 587 Professor Lloyd M. Basham June 8, 2014 (The above [and the next 3 lines]...

I need the multiple choice questions answers from chapter 4 and 5 of the attached & Monograph...

Create four language guidelines: two for Spanish and two for English, each with a descriptive and required component. This chapter is a brief introduction to modern linguistics and to topics that...

Consider the following servlet implementing a micro-blog entry public class AddMBlogEntry extends HttpServlet ( Public void doPost(HttpServletRequest req.. HttpServletResponse res) Throws...

Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG

What does a low interest coverage ratio suggest? High profitability Efficient inventory management Difficulty meeting interest payments Low risk of default

Explain and summarize the best way to calculate Bonnies and Jims salary increase that will promote and increase performance by both of these employees. Explain your reasoning.

Under a merit pay system, lets assume the goal is to provide Bonnie and Jim the same annual pay increases as measured in dollars, just for 2016. Its been determined that Bonnies annual increase rate...

Under a merit pay system, calculate Bonnies salary ($50,000) based on 7 percent annual increase in 2016 through the year 2020. For Jim ($35,000), apply a 3 percent annual increase rate. What are the...

1 and y = on the interval [2,11]. Find the area of the region bounded by the curves y = .3 - 3x 3 Set up the integral that gives the area of the region. Use increasing limits of integration. Select...

Explain what you understand by Block-chain and text Mining and give 2 examples each Also, discuss their relevance in audit and Accounting?

unlike time series forecasts associative models of forecasting.. a) summarize the effects of predictor variables b) compute a moving average c) rely on qualitative measures of prediction, such as...

12. The form of creative action strategy, where would you say you have a strength, as a dreamer, as a realist or as a critic?

16. Now put the areas you have ranked in order of priority and reflect on which values they correspond to in your value hierarchy.

14. Now reconcile what you answered to problem 15 with problem 13.