In a certain type of automobile engine, the cylinder head is fastened to the block by 10
Question:
In a certain type of automobile engine, the cylinder head is fastened to the block by 10 bolts, each of which should be torqued to 60N· m. Assume that the torques of the bolts are independent.
a. If each bolt is torqued correctly with probability 0.99, what is the probability that all the bolts on a cylinder head are torqued correctly?
b. The goal is for 95% of the engines to have all their bolts torqued correctly. What must be the probability that a bolt is torqued correctly in order to reach this goal?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 88% (9 reviews)
a 099 10 0904 b L...View the full answer
Answered By
Lamya S
Highly creative, resourceful and dedicated High School Teacher with a good fluency in English (IELTS- 7.5 band scorer) and an excellent record of successful classroom presentations.
I have more than 2 years experience in tutoring students especially by using my note making strategies.
Especially adept at teaching methods of business functions and management through a positive, and flexible teaching style with the willingness to work beyond the call of duty.
Committed to ongoing professional development and spreading the knowledge within myself to the blooming ones to make them fly with a colorful wing of future.
I do always believe that more than being a teacher who teaches students subjects,...i rather want to be a teacher who wants to teach students how to love learning..
Subjects i handle :
Business studies
Management studies
Operations Management
Organisational Behaviour
Change Management
Research Methodology
Strategy Management
Economics
Human Resource Management
Performance Management
Training
International Business
Business Ethics
Business Communication
Things you can expect from me :
- A clear cut answer
- A detailed conceptual way of explanation
- Simplified answer form of complex topics
- Diagrams and examples filled answers
4.90+
46+ Reviews
54+ Question Solved
Related Book For
Question Posted:
Students also viewed these Mathematics questions
-
Your battery is dead: The lifetimes of a certain type of automobile battery are normally distributed with mean 5.9 years and standard deviation 0.4 year. The batteries are guaranteed to last at least...
-
The manufacturer of a certain type of automobile claims that under typical urban driving conditions the automobile will travel on average at least 20 miles per gallon of gasoline. The owner of this...
-
A certain type of automobile battery is known to last an average of 1110 days with a standard deviation of 80 days. If 400 of these batteries are selected, find the following probabilities for the...
-
Figure 11-31 shows a cooling curve for a Pb-Sn alloy. Determine (a) The pouring temperature; (b) The superheat; (c) The liquidus temperature; (d) The eutectic temperature; (e) The freezing range; (f)...
-
The fastest 10 percent of runners who complete the Nosy Neighbor 5K race win a gift certificate to a local running store. Assuming a normal distribution, how many standard deviations below the mean...
-
If V1 = 456 mL, P1 = 308 torr, and P2 = 1.55 atm, what is V2?
-
The data below represent the fraction of active chlorine in a chemical product as a function of time after manufacturing. a. Construct a scatterplot of the data. b. Fit the Mitcherlich law (see...
-
Your client, John Butler, is an avid Houston Astros fan. Last March at the Astros' home opener, as a result of a random drawing of those in attendance at the game, John won 300 Shipley Do-Nut...
-
Using the account details provided below, prepare a single-step Income Statement for Chariot Consulting's fiscal year end. List each applicable account on a separate line. Account Balance Accounts...
-
1. Considering Yips globalisation framework (Figure 9.2), what drivers of internationalisation do you think were most important when Wanda entered the US market through its AMC and Legendary...
-
A laminated item is composed of five layers. The layers are a simple random sample from a population whose thickness has mean 1.2 mm and standard deviation 0.04 mm. a. Find the mean thickness of an...
-
A box contains 15 resistors. Ten of them are labeled 50 and the other five are labeled 100 . a. What is the probability that the first resistor is 100 ? b. What is the probability that the second...
-
Use a calculator to display the region in which the points satisfy the given inequality or system of inequalities. y > |x 1| y < 4 + Inx
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
1. What do you think of the way in which Ali was approached by Dr. Shields about her violation of the dress code? Does this seem advisable to you? 2. How much of a role do you think different...
-
Consider a closed, rigid tank with a volume of 0.8L, filled with cold water initially at 27C. The tank is filled such that there are no voids (air pockets) within. The initial pressure within the...
-
The breaking strength of hockey stick shafts m de of two different grphite-Kevl r composites yield the following results (in newtons): Find a 98% confidence interval for the difference between the...
-
A computer system administrator notices that computers running a particular operating system seem to freeze up more often as the installation of the operating system ages. She measures the time (in...
-
A computer system administrator notices that computers running a particular operating system seem to freeze up more often as the installation of the operating system ages. She measures the time (in...
-
Explain organizational change and briefly discuss the three types of change? ( 350 words please)
-
Identify an organization that has experienced change Classify the type of organizational change the organization experienced Describe how the organization overcame the resistance to the change...
-
Carlton Bank has an increase in reserves of $1,000,000. If the reserve ratio is 10%, by what amount may Carlton increase its demand deposits?
Study smarter with the SolutionInn App