Question: A fault has the following attitude: 080, 48S. Using orthographic projection, determine the apparent dip of this fault in a vertical cross section striking 295.

A fault has the following attitude: 080°, 48°S. Using orthographic projection, determine the apparent dip of this fault in a vertical cross section striking 295°.

Step by Step Solution

★★★★★

3.51 Rating (154 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

To determine the apparent dip of a fault in a vertical cross section you can use the following formu... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Structural Analysis Questions!

CCSU scholars investigated whether the attributes of customer service quality and mobile app design quality predict mobile shoppers' Trust, Repurchase Intention, or Recommendation Intention. From 286...

Solve Problems 1.4 and 1.5 using the alignment diagram (Fig. 1.7). Problem 1.4 Along a railroad cut, a bed has an apparent dip of 20 in a direction of N62W. The bed strikes N67E. Using orthographic...

Solve Problem 1.5 using trigonometry. Problem 1.5 A fault has the following attitude: 080, 48S. Using orthographic projection, determine the apparent dip of this fault in a vertical cross section...

A fault plane is intersected by two mine adits. In one adit the plunge and trend of the apparent dip is 20, N10W, and in the other it is 32, N85W. Use orthographic projection to determine the...

EXPERIMENTAL SECTION L- G Fault Analysis 1.1 EXPERLMENTAL OBJECTIVE To analyze and calculate different fault currents that occur due to the introduction of faults (L-G. ) in transmission line using...

Which of the following virtual addresses WILL generate a page fault? segment page offset |0|0| 41 | 20 | 41 | 3 | 2 | 41 3 1 1 . None of the above addresses will generate a page fault Which of...

c C lang Consider a machine with a 12KB physical memory space running an OS that uses a 4KB virtual memory space for its processes. The machine is executing two processes (A and B), where each...

Excused Performance When Circumstances Change I. Introduction Circumstances change. Contracts made in good times may have to be performed in bad times. The cost of the seller's raw materials may...

For the system of Problem 9.11, compute the fault current and voltages at the fault for the following faults at point $\mathrm{F}$ : (a) a bolted single line-to-ground fault; (b) a line-to-line...

For the system of Problem 9.12, compute the fault current and voltages at the fault for the following faults at bus 3: (a) a bolted single line-toground fault, (b) a bolted line-to-line fault, (c) a...

computePrimes() has a fault that causes it not to include prime numbers whose last digit is 9. For example, it omits 19, 29, 59, 79, 89, 109, ... Answer the following questions a through f, if the...

The sales department of Optimo Company has forecast sales for May 2011 to be 40,000 units. Additional information follows: Finished goods inventory, May 1 . . . . . . . . . . . . . . . . . . . . . ....

Wildcat Ltd, a manufacturing company sold a machinery for Rs 8 lacs at the year end. The company had purchased the machinery four years back for Rs 15 lacs and had depreciated the same using written...

A bond is redeemed at premium when: Question 5 Answer a . C ) Redemption price Face value d . B ) Redemption price = Face value

Consider the gain plot in Figure P1255. (a) Find the transfer function corresponding to the straightline gain plot. (b) Use MATLAB to plot the Bode magnitude of the transfer function. (c) Design a...

Why is a thermostable form of DNA polymerase (e.g., Taq polymerase) used in PCR? Is it necessary to use a thermostable form of DNA polymerase in the techniques of dideoxy DNA sequencing or...

The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...

When comparing the coding region of protein-encoding genes among closely related species, certain regions of the gene are commonly found to have evolved more rapidly (i.e., have tolerated more...

Biscay Bay Boats established a petty cash fund for minor day-to-day expenses. Following are activities related to this fund. Prepare the necessary journal entries for petty cash under imprest system...

Which of the following is true about cash as a method of paying employees? Cash is the most secure payment method. Cash is the most widely used payment method. Cash is readily transferable and highly...

journal entries..please.. Paid Light Hardware, Inc. $18,200.00 in payment of the December 31 balance. Applied $2,654.28 of direct materials to Job No. 1402. (Materials Requisition No. 1682.) Received...