The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved

Question:

The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved with trypsin with chymotrypsin?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Organic Chemistry

ISBN: 9780495112587

7 Edition

Authors: John McMurry

See More Books

Question Posted: Mar 08, 2011 05:48 AM

See More Questions

Angiotensin II is an octapeptide with vasoconstrictor activity. Complete hydrolysis gives one equivalent each of Arg, Asp, His, Ile, Phe, Pro, Tyr, and Val. Reaction with Sanger's reagent gives,...
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
If you were examining a sequence of chromosomal DNA, what characteristics would cause you to believe that the DNA contained a transposable element?
Design a disc brake with a double caliper. Each side of the disc has two 40-mm-diameter pads. The center of the brake pads is at a radius of 150 mm. The outside diameter of the disk is 360 mm. The...
If your social media monitoring efforts pick up a tweet that accuses your customer service staff of lying and claims to have evidence to back it up, how would you respond?
Michelle Co. its operation in 2030. The following transactions and events occurred during the year: 1. Michelle invested P1,500,000 cash to the business. 2. Borrowed 12%, one year loan amounting to...
A distillation tower with sieve trays is to separate benzene from mono-chlorobenzene. Conditions at a plate near the bottom of the column are: Vapor Phase Mass flow rate \(=24,850 \mathrm{lb} /...
The text mentioned a model of predatory pricing in which an incumbent tries to ''beat up'' a rival, exhausting the resources the rival needs to continue operating in the market, causing it to exit....
1. Why does video conferencing have high information richness? 2. What are emotional disconnects and why do they matter in business communication? 3. List the stages in Tuckman's model of group...
Please provide the answers in excel with the formulas and explanation. The administrator of Pearland Nursing Home is very aware of needing to keep his cost down since he just negotiated a new...
Show the structures of the products obtained on reaction of valine with ninhydrin.
What is the N-terminal residue on a peptide that gives the following PTH derivative on Edmandegradation?
Indicate the class of hydrocarbon derivative for each of the following compounds. (a) (CH3)2CH-OH (c) -C-CHCH3 (b) (d) CH3-0- (0) H-C-NH2
Several car mechanics at Firestone had their tools stolen by vandals overnight. The mechanics sued Firestone for a breach of their Bailment agreement. Firestone claims there was never a Bailment...
Case study John and Laura had purchased their first home for $600,000. They approached the bank for a mortgage they required a down payment. Two friends Larry and Kerry came forward and offered to...
The Mad Beach Pub is a small casual restaurant located in YOUR STATE.The business is privately owned and currently has 4 full time employees and 15 part time employees. Mandie, a 46 year old...
Watch the following two video clips, after work in groups to answer the following questions. 1.Apply social identity theory and self-concept to explain Mitch's perception of himself as a doctor....
A religious accommodation claim is different from a disparate treatment claim. An individual alleging denial of religious accommodation is seeking an adjustment of a neutral work rule that infringes...
Piyush has recently inherited 20 million INR (Indian rupees) from his late uncle Scrooge. To keep Piyush from spending his money immediately, Scrooge made arrangements for the inheritance to be...
Distinguish among total-moisture content, free-moisture content, equilibrium-moisture content, unbound moisture, and bound moisture.
Carbon dioxide dissolves in water according to the equations: Carbon dioxide levels in the atmosphere have increased about 20% over the last century. Given that Earths oceans are exposed to...
How many hydrogens are replaced by deuterium when each of the following compounds is treated with NaOD in D2O? a. 3-methylcyclopentanone b. 3-methylhexanal
As described in "A Word About . . . Water Treatment and the Chemistry of Enols/Enolates," carbonyl compounds can become halogenated by treatment with a base and a halogen source, such as Cl2....
Write out the steps in the mechanism for the aldol condensation of butanal (the first step in the synthesis of the mosquito repellent "6-12," eq. 9.57).
Pretend you need to conduct a title search. You have the information needed from your online search, but you need to go to the clerk's office to finish your search. What information/records will/can...
Watch the Tedx Talk (Melvin Russell: I love being a police officer, but we need reform) by Lt. Colonel Melvin Russel from the Baltimore Police. In his talk, he discusses how law enforcement is in...
Solve for X. Assume X is a 2 x 2 matrix. Do not use decimal numbers in your answer. If there are fractions, leave them unevaluated. X = # 6 X+ 7 = 7 8 X. [24]*+41-41 -5

The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved

Question:

Step by Step Answer:

Trypsin cleaves peptide bonds at the carboxyl side of ...View the full answer

Organic Chemistry

Students also viewed these Organic Chemistry questions