Question: A sprinter in a 400-m race accelerates uniformly for the first 130 m and then runs with constant velocity. If the sprinters time for the

A sprinter in a 400-m race accelerates uniformly for the first 130 m and then runs with constant velocity. If the sprinter’s time for the first 130 m is 25 s, determine
(a) His acceleration,
(b) His final velocity,
(c) His time for the race.

Step by Step Solution

★★★★★

3.39 Rating (161 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

a During the acceleration phase x x vot at Using xo 0 and vo 0 and solving fo... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

4-E-M-E-VM (1414).docx

120 KBs Word File

Students Have Also Explored These Related Mechanical Engineering Questions!

A sprinter accelerates from rest to 9.00 m / s in 1.38 s. What is her acceleration in (a) m / s2; (b) km / h2?

A sprinter of mass 65.0 kg starts his race by pushing horizontally backward on the starting blocks with a force of 200 N. (a) What force causes him to accelerate out of the blocks: (1) his push on...

A car accelerates from 14 m / s to 21 m / s in 6.0 s. What was its acceleration? How far did it travel in this time? Assume constant acceleration.

A sprinter in a 1 0 0 - m race accelerates uniformly for the first 3 5 mand then runs with constant velocity. If the sprinters time for the first 3 5 m is 5 . 4 s , determine ( a ) his acceleration,...

A sprinter in a 1 0 0 - m race accelerates uniformly for the first 3 5 m and then runs with constant velocity. If the sprinter s time for the first 3 5 m is 5 . 4 s , determine ( a ) his...

4 Question 4 (1 point) Below is a histogram and the five-number summary for salaries (in $) for a sample of marketing managers. The upper and lower "fences" for a boxplot of these data are.... Min Q1...

A sprinter in a 100-m race accelerates uniformly for the first 35 m and then runs with constant velocity. If the sprinters time for the first 35 m is 5.4 s, determine (a) His acceleration, (b) His...

Acceleration: Instantaneous and Constant Practice Sheet Show your work. No work shown, NO CREDIT. A race car's velocity increases from 4.0 m/s to 36 m/s over a 4.0 s time interval. What is its...

71A sprinter running the 100meter dash is known to accelerate for the * 1 point first few seconds of the race and then to run at constant speed the rest of the way. It is desired to design an...

Please help! 81. 81. Ill Careful measurements have been made of Olympic sprinters in the 100 meter dash, A simple but reasonably accurate model is that a sprinter accelerates at 3.6 mfs2 for 3% s,...

Design a helical spring for a spring loaded safety valve for the following conditions : Operating pressure = 1 N/mm? Maximum pressure when the valve blows off freely = 1.075 N/mm2? Maximum lift of...

Aspirin (pictured below) is an acid with logP of 1.19. What does logP tell you? How do you expect its structure to change with changing pH? How do you expect its logP to change with changing pH?

What are the positive and negative limbs of s 8 - 1 ITAA 9 7 ? What is the difference between a loss and an outgoing ? What is the effect of the words to the extent that in s 8 - 1 ? What tests have...

Show that the Hamiltonian H = (p/2m) + V commutes with all three components of L, provided that V depends only on r. (Thus H, L, and L. are mutually compatible observables.) %3D

1. How does chapter 4 begin? What conversation does Starr walk into? Why is it important? use MLA format quoting https://www.sparknotes.com/lit/the-hate-u-give/ Read from chapter 4 and answer this...

Set up the appropriate form of a particular solution y, but do not determine the valcys of the coefficients. y6) + yl@) = cos(r) + 2r 5 %3D Ar + Bx2 + Cx+ Dxcos(r) + Frsin(r) Ar? + Br+ C+ Dcos(x) +...

the dimensions are a = 6 mm and b = 8 mm . Given that: dA for Ix is = 6*(sqrt(y/8)-y/8)dy dA for Iy is = 8/6*(1-(x/6))xdx After computing further, we get: Ix=110m^(4), Iy=86.4m^(4) Find the polar...

In 1859, 24 rabbits were released into the wild in Australia, where they had no natural predators. Their population grew exponentially, doubling every 6 months. (a) Determine P(t), the function that...

The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3

A cryogenic fluid as liquid nitrogen at 90 K, 400 kPa flows into a probe used in cryogenic surgery. In the return line the nitrogen is then at 160 K, 400 kPa. Find the specific heat transfer to the...

A small stream with 20oC water runs out over a cliff creating a 100 m tall waterfall. Estimate the downstream temperature when you neglect the horizontal flow velocities upstream and downstream from...

A small water pump is used in an irrigation system. The pump takes water in from a river at 10oC, 100 kPa at a rate of 5 kg/s. The exit line enters a pipe that goes up to an elevation 20 m above the...

Bellwood Corp. is comparing two different capital structures. Plan I would result in 23,000 shares of stock and $81,000 in debt. Plan II would result in 17,000 shares of stock and $243,000 in debt....

Suppose the expected returns and standard deviations of stocks A and B are E( RA ) = 0.13, E( RB ) = 0.19, A = 0.28, and B = 0.52, respectively. (a) Calculate the expected return and standard...

Consider the following scenario: Company A contracts with Company B to supply widgets. At the time of signing the contract B pays $175 in advance for the widgets, which it plans to sell in turn for...