As described in "A Word About . . . Green Chemistry: Alternative Uses for Carbohydrates" (page 484), succinic acid can be prepared enzymatically from renewable resources, such as glucose. Suggest a...
Arginine shows three pKa's: at 2.17 (the --COOH group), at 9.04 (the --N1H3 group), and at 12.48 (the guanidinium ion). Write equilibria (similar to eq. 17.6) for its dissociation. At approximately...
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
How many valence electrons does carbon have?
A pentapeptide was converted to its DNP derivative, then completely hydrolyzed and analyzed quantitatively. It gave DNP-methionine, 2 moles of methionine, and 1 mole each of serine and glycine. The...
Angiotensin II is an octapeptide with vasoconstrictor activity. Complete hydrolysis gives one equivalent each of Arg, Asp, His, Ile, Phe, Pro, Tyr, and Val. Reaction with Sanger's reagent gives,...
Among the following four structures, one is not a permissible resonance form. Identify the wrong structure. Why is it incorrect? CH2-N-O: 0: CH,-N-0: CH3 CH3 CH3 CH3
(a) Write a Lewis structure for sulfur dioxide in which the octet rule is satisfied for all three atoms. Show all electron pairs and include any formal charges. The atoms are connected in the order...
The reactions shown will all be encountered in Chapter 6. Classify each according to whether it proceeds by oxidation of carbon, by reduction of carbon, or by a process other than...
Write a structural formula for each of the following compounds: (a) 6-Isopropyl-2,3-dimethylnonane (b) 4-tert-Butyl-3-methylheptane (c) 4-Isobutyl-1,1-dimethylcyclohexane (d) sec-Butylcycloheptane...
Apply the VSEPR method to deduce the geometry around carbon in each of the following species: (a) (b) (c) CH3 CH3 CH2
Account for all the electrons in each of the following species, assuming sp3 hybridization of the second-row element in each case. Which electrons are found in sp3-hybridized orbitals? Which are...
All the parts of this problem refer to the alkane having the carbon skeleton shown. (a) What is the molecular formula of this alkane? (b) What is its IUPAC name? (c) How many methyl groups are...
Give the IUPAC name for each of the following alkyl groups, and classify each one as primary, secondary, or tertiary: (a) CH3(CH2)10CH2-- (b) (c) --C(CH2CH3)3 (d) (e) (f) -CH2CH2CHCH2CH2CH3 CH2CH3...
(a) Write Newman projections for the gauche and anti conformations of 1,2-dichloroethane (ClCH2CH2Cl). (b) The measured dipole moment of ClCH2CH2Cl is 1.12 D. Which one of the following statements...
Assuming the relative rate of secondary to primary hydrogen atom abstraction to be the same in the chlorination of propane as it is in that of butane, calculate the relative amounts of propyl...
Assuming that the rate-determining step in the reaction of cyclohexanol with hydrogen bromide to give cyclohexyl bromide is unimolecular, write an equation for this step. Use curved arrows to show...
Assuming that the rate-determining step in the reaction of 1-hexanol with hydrogen bromide to give 1-bromohexane is an attack by a nucleophile on an alkyloxonium ion, write an equation for this step....
A typical steroid skeleton is shown along with the numbering scheme used for this class of compounds. Specify in each case whether the designated substituent is axial or equatorial. (a) Substituent...
(a) Menthol, used to flavor various foods and tobacco, is the most stable stereoisomer of 2- isopropyl-5-methylcyclohexanol. Draw or make a molecular model of its most stable conformation. Is the...
Among the isomeric alkanes of molecular formula C5H12, identify the one that on photochemical chlorination yields (a) A single monochloride (b) Three isomeric monochlorides (c) Four isomeric...
As noted in Problem 4.7, hydrogen cyanide (HCN) has a pKa of 9.1. Is cyanide ion (CN-) a stronger base or a weaker base than hydroxide ion (HO-)?
(a) Suggest an explanation for the fact that 1-methylcyclopropene is some 42 kJ/mol (10 kcal/mol) less stable than methylenecyclopropane. (b) On the basis of your answer to part (a), compare the...
Give the structures of two different alkyl bromides both of which yield the indicated alkene as the exclusive product of E2 elimination. (a) CH3CH==CH2 (b) (CH3)2C==CH2 (c) BrCH=CBr2 (d) CH3
Acid-catalyzed dehydration of 2,2-dimethyl-1-hexanol gave a number of isomeric alkenes including 2-methyl-2-heptene as shown in the following formula. (a) Write a stepwise mechanism for the formation...
Each of the following alcohols has been subjected to acidcatalyzed dehydration and yields a mixture of two isomeric alkenes. Identify the two alkenes in each case, and predict which one is the major...
(a) The sex attractant of the Mediterranean fruit fly is (E)-6-nonen-1-ol. Write a structural formula or build a molecular model for this compound, showing the stereochemistry of the double bond. (b)...
Arrange the following alkenes in order of decreasing stability: 1-pentene; (E)-2-pentene; (Z)-2-pentene; 2-methyl-2-butene.
Arrange the compounds 2-methyl-1-butene, 2-methyl-2-butene, and 3-methyl-1-butene in order of decreasing reactivity toward bromine.
(a) Which primary alcohol of molecular formula C5H12O cannot be prepared from an alkene? Why? (b) Write equations describing the preparation of three isomeric primary alcohols of molecular formula...
All the following reactions have been reported in the chemical literature. Give the structure of the principal organic product in each case. (a) (b) (c) (d) (e) (f) (g) (h) (i) no peri CH,CH CH CHCH...
A single epoxide was isolated in 79-84% yield in the following reaction. Was this epoxide A or B? Explain your reasoning. CH;COOH B.
As a method for the preparation of alkenes, a weakness in the acid-catalyzed dehydration of alcohols is that the initially formed alkene (or mixture of alkenes) sometimes isomerizes under the...
Addition of hydrogen chloride to 3,3-dimethyl-1-butene gives a mixture of two isomeric chlorides in approximately equal amounts. Suggest reasonable structures for these two compounds, and offer a...
Give the major organic product formed when hydrogen bromide reacts with each of the alkenes in Problem 6.3 in the absence of peroxides and in their presence. In Problem 6.3 Write the structure of the...
A second category of six-carbon carbohydrates, called 2-hexuloses, has the constitution shown. How many stereoisomeric 2-hexuloses are possible? HOCH2CCH CH- CHCH2OH OH OH OH A 2-hexulose
A subrule of the Cahn-Ingold-Prelog system specifies that higher mass number takes precedence over lower when distinguishing between isotopes. (a) Determine the absolute configurations of the...
(a) On being heated with potassium ethoxide in ethanol (70C), the deuterium-labeled alkyl bromide shown gave a mixture of 1-butene, cis-2-butene, and trans-2-butene. On the basis of your knowledge of...
Assign absolute configurations as R or S to each of the following compounds: a. b. c. H3C -CH2F CH3CH2 (+)-1-Fluoro-2-methylbutane CH3 C-CH2Br CH3CH2 (+)1-Bromo-2-methylbutane H3C -CH CH2 ...
All the reactions of 1-bromopropane in the preceding problem give the product of nucleophilic substitution in high yield. High yields of substitution products are also obtained in all but one of the...
A single organic product was obtained when 1-bromo-3-chloropropane was allowed to react with one molar equivalent of sodium cyanide in aqueous ethanol. What was this product?
Arrange the isomers of molecular formula C4H9Cl in order of decreasing rate of reaction with sodium iodide in acetone.
(a) Suggest a reasonable series of synthetic transformations for converting trans-2 methylcyclopentanol to cis-2-methylcyclopentyl acetate. (b) How could you prepare cis-2-methylcyclopentyl acetate...
Streptimidone is an antibiotic and has the structure shown. How many diastereomers of streptimidone are possible? How many enantiomers? Using the E,Z and R,S descriptors, specify all essential...
A sample of synthetic cholesterol was prepared consisting entirely of the enantiomer of natural cholesterol. A mixture of natural and synthetic cholesterol has a specific rotation []D20 of -13. What...
An unknown acetylenic amino acid obtained from the seed of a tropical fruit has the molecular formula C7H11NO2. On catalytic hydrogenation over platinum this amino acid yielded homoleucine (an amino...
When 1,2-dibromodecane was treated with potassium hydroxide in aqueous ethanol, it yielded a mixture of three isomeric compounds of molecular formula C10H19Br. Each of these compounds was converted...
All the following reactions have been described in the chemical literature and proceed in good yield. In some cases the reactants are more complicated than those we have so far encountered....
Assume that you need to prepare 4-methyl-2-pentyne and discover that the only alkynes on hand are acetylene and propyne. You also have available methyl iodide, isopropyl bromide, and...
Give the structures of three isomeric dibromides that could be used as starting materials for the preparation of 3,3-dimethyl-1-butyne.
Addition of hydrogen chloride to 2-methyl-1,3-butadiene is a kinetically controlled reaction and gives one product in much greater amounts than any isomers. What is this product?
Give the IUPAC names for each of the following compounds: (a) CH2CH(CH2)5CHCH2 (b) (c) (CH2CH)3CH (d) (e) (f) CH2CCHCHCHCH3 (g) (h) CH3 CHz CH3 HH CI CI H H H3C CH,CH2 CH2CH3
(a) What compound of molecular formula C6H10 gives 2,3-dimethylbutane on catalytic hydrogenation over platinum? (b) What two compounds of molecular formula C11H20 give 2,2,6,6-tetramethylheptane on...
A certain species of grasshopper secretes an allenic substance of molecular formula C13H20O3 that acts as an ant repellent. The carbon skeleton and location of various substituents in this substance...
Show how you could prepare each of the following compounds from propene and any necessary organic or inorganic reagents: (a) Allyl bromide (e) 1,2,3-Tribromopropane (b) 1,2-Dibromopropane (f) Allyl...
Alkenes slowly undergo a reaction in air called autoxidation in which allylic hydroperoxides are formed. OOH Cyclohexene Oxygen 3-Hydroperoxycyclohexene 0:0)
Assume that N-bromosuccinimide serves as a source of Br2, and write equations for the propagation steps in the formation of 3-bromocyclohexene by allylic bromination of cyclohexene.
Another way in which energies of isomers may be compared is by their heats of combustion. Match the heat of combustion with the appropriate diene. Dienes: 1,2-Pentadiene, (E)-1,3-pentadiene,...
A standard method for the preparation of sodium cyclopentadienide (C5H5Na) is by reaction of cyclopentadiene with a solution of sodium amide in liquid ammonia. Write a balanced equation for this...
A very large number of Diels-Alder reactions are recorded in the chemical literature, many of which involve relatively complicated dienes, dienophiles, or both. On the basis of your knowledge of...
Write a structural formula for each of the following compounds: (a) m-Chlorostyrene (b) p-Nitroaniline
A compound was obtained from a natural product and had the molecular formula C14H20O3. It contained three methoxy (-OCH3) groups and a -CH2CH=C(CH3)2 substituent. Oxidation with either chromic acid...
Acridine is a heterocyclic aromatic compound obtained from coal tar that is used in the synthesis of dyes. The molecular formula of acridine is C13H9N, and its ring system is analogous to that of...
A single organic product was isolated after Birch reduction of p-xylene. Suggest a reasonable structure for this substance.
Arrange the following five compounds in order of decreasing rate of bromination: benzene, toluene, o-xylene, m-xylene, 1,3,5-trimethylbenzene (the relative rates are 2 107, 5 104, 5 102, 60, and...
(a) Figure 11.16 is an electrostatic potential map of calicene, so named because its shape resembles a chalice (calix is the Latin word for "cup"). Both the electrostatic potential map and its...
Write equations showing how you could prepare each of the following from anisole and any necessary organic or inorganic reagents. If an ortho, para mixture is formed in any step of your synthesis,...
Reaction of benzanilide with chlorine in acetic acid yields a mixture of two monochloro derivatives formed by electrophilic aromatic substitution. Suggest reasonable structures for these two isomers....
A standard synthetic sequence for building a six-membered cyclic ketone onto an existing aromatic ring is shown in outline as follows. Specify the reagents necessary for each step. CCH2CH2COH CH...
max for the * transition in ethylene is 170 nm. Is the HOMO-LUMO energy difference in ethylene greater than or less than that of cis,trans-1,3-cyclooctadiene?
From among the isomeric compounds of molecular formula C4H9Cl, choose the one having a 1H NMR spectrum that (a) Contains only a single peak (b) Has several peaks including a doublet at 3.4 ppm (c)...
31P is the only phosphorus isotope present at natural abundance and has a nuclear spin of 1/2The 1H NMR spectrum of trimethyl phosphite, (CH3O)3P, exhibits a doublet for the methyl protons with a...
A particular vibration will give an absorption peak in the infrared spectrum only if the dipole moment of the molecule changes during the vibration. Which vibration of carbon dioxide, the symmetrical...
Microwave spectroscopy is used to probe transitions between rotational energy levels in molecules. (a) A typical wavelength for microwaves is 10-2 m, compared with 10-5 m for infrared radiation. Is...
Describe the appearance of the 1H NMR spectrum of each of the following compounds. How many signals would you expect to find, and into how many peaks will each signal be split? (a)...
Describe the appearance of the 1H NMR spectrum of each of the following compounds. How many signals would you expect to find, and into how many peaks will each signal be split? (a) CH3CH2OCH3 (b)...
Write the structure of the principal organic product of each of the following reactions: (a) 1-Bromopropane with lithium in diethyl ether (b) 1-Bromopropane with magnesium in diethyl ether (c)...
Analyze the following structures so as to determine all the practical combinations of Grignard reagent and carbonyl compound that will give rise to each: (a) (c) (CH3)3CCH2OH (d)...
A number of drugs are prepared by reactions of the type described in this chapter. Indicate what you believe would be a reasonable last step in the synthesis of each of the following: (a) CH,CH2CC...
Addition of phenylmagnesium bromide to 4-tert-butylcyclohexanone gives two isomeric tertiary alcohols as products. Both alcohols yield the same alkene when subjected to acid-catalyzed dehydration....
Alfred Nobel's fortune was based on his 1866 discovery that nitroglycerin, which is far too shock-sensitive to be transported or used safely, can be stabilized by adsorption onto a substance called...
(a) Unlike other esters, which react with Grignard reagents to give tertiary alcohols, ethyl Formate yields a different class of alcohols on treatment with Grignard reagents. What kind of alcohol is...
Predict the products formed on oxidation of each of the following with periodic acid: (b) (CH3)2CHCH2CHCHCH2C6H5 HO OH CH2OH
Sorbitol is a sweetener often substituted for cane sugar, since it is better tolerated by diabetics. It is also an intermediate in the commercial synthesis of vitamin C. Sorbitol is prepared by...
Write equations showing how 2-phenylethanol (C6H5CH2CH2OH) could be prepared from each of the following starting materials: (a) Bromobenzene (b) Styrene (c) 2-Phenylethanal (C6H5CH2CHO) (d) Ethyl...
(a) The cis isomer of 3-hexen-1-ol (CH3CH2CH=CHCH2CH2OH) has the characteristic odor of green leaves and grass. Suggest a synthesis for this compound from acetylene and any necessary organic or...
Complete the following series of equations by writing structural formulas for compounds A through I: NaHCO Na Cr-0 Compound A Compound B Compound C I. O 2reductive Compound DpCompound E NaRH pyrdine...
Each of the following alcohols has been prepared by reaction of a Grignard reagent with ethylene oxide. Select the appropriate Grignard reagent in each case. (a) CH3 CH2CH2OH CH2CH20
A diol (C8H18O2) does not react with periodic acid. Its 1H NMR spectrum contains three singlets at 1.2 (12 protons), 1.6 (4 protons), and 2.0 ppm (2 protons). What is the structure of this diol?
Identify compound A (C8H10O) on the basis of its 1H NMR spectrum (Figure 15.6). The broad peak at δ 2.1 ppm disappears when D2O is added. 3 Compound A CsH1o0) 7.4 7.2 nnm) 10.0 9.0 8.0...
Give the structures, including stereochemistry, for the diols obtained by hydroxylation of cis-2-butene and trans-2-butene.
On the basis of the mechanism for the acid-catalyzed formation of diethyl ether from ethanol in Figure 15.2, write a stepwise mechanism for the formation of oxane from 1,5-pentanediol (see the...
Write the structure of the ester formed in each of the following reactions: 10H H,So heat (C10H10O4) 2CH3OH HOC
Adapt the mechanism shown in Figure 16.4 to the reaction: 589 Tetrahydrofuran 1,4-Dilodobutane (65%)
Which product, compound A, B, or C, would you expect to be formed when 1-methyl-1,2-epoxycyclopentane of the absolute configuration shown is allowed to stand in methanol containing a few drops of...
Although epoxides are always considered to have their oxygen atom as part of a threemembered ring, the prefix epoxy in the IUPAC system of nomenclature can be used to denote a cyclic ether of various...
Among the ways in which 1,4-dioxane may be prepared are the methods expressed in the equations shown: a. b. 2HOCH CH,OHC +2H20 eat Ethylene glycol 1.4-Dioxane Water NaOH CICH-CH-OCHCHCl- - - Bis...
The 1H NMR spectrum of compound A (C8H8O) consists of two singlets of equal area at 5.1 (sharp) and 7.2 ppm (broad). On treatment with excess hydrogen bromide, compound A is converted to a single...
A series of dialkyl ethers was allowed to react with excess hydrogen bromide, with the following results. Identify the ether in each case. (a) Another ether gave only benzyl bromide. (b) A third...
Acetal formation is a characteristic reaction of aldehydes and ketones, but not of carboxylic acids. Show how you could advantageously use a cyclic acetal protecting group in the following synthesis:...