How did Caterpillar use strategy as a real hedge to reduce its exposure to foreign exchange risk?

Question:

How did Caterpillar use strategy as a "real hedge" to reduce its exposure to foreign exchange risk? What is the downside of its approach?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

International Business Competing in the Global Marketplace

ISBN: 978-1259578113

11th edition

Authors: Charles W. L. Hill

See More Books

Question Posted: May 26, 2017 10:06 AM

See More Questions

What is the downside of both direct and indirect intervention?
What do commodities protect against? What is the downside to commodity investment?
1. Lawrence Company ordered parts costing FC100,000 from a foreign supplier on May 12 when the spot rate was $0.20 per FC. A one-month forward contract was signed on that date to purchase FC100,000...
The SEC Form 10-K of Google is reproduced online at www.wiley.com/college/pratt. REQUIRED: Review the Google 2012 SEC Form 10-K, and answer the following questions: a. Compute Googles long-term debt...
Determine the smallest vertical force P required to hold the wedge between the two identical cylinders, each having a weight of W. The coefficient of static friction at all contacting surfaces is ? s...
Moonbeam Company manufactures toasters. For the first 8 months of 2017, the company reported the following operating results while operating at 75% of plant capacity: Sales (350,000...
National Life Expectancies. We continue the analysis begun in Exercises 1.7and 2.22 Now fit a regression model on LIFEEXP using three explananatural logarithmic transform of PRIVATEHEALTH). a....
Your task is to apply appropriate differences analysis using the surveys desirability measures in your GlobalMotors.sav SPSS dataset to determine the target market descriptions for each of the five...
Private Equity Associates ("Associates") is a limited partnership that buys, restructures, and then sells companies that are not publicly traded. Manager, the sole general partner of Associates, is...
Consumer Reports provided overall customer satisfaction scores for AT&T, Sprint, T-Mobile, and Verizon cell-phone services in major metropolitan areas throughout the United States. The rating for...
In the 1980s a stronger dollar hurt Caterpillar's competitive position, but in 2008 a stronger dollar did not seem to have the same effect. What had changed?
Explain the difference between transaction exposure and translation exposure using the material in the Caterpillar case to illustrate your answer.
The following table summarizes the average annual return and the standard deviation of returns for several types of securities over the past 75 years. Assume annual returns in each case are...
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
The unadjusted trial balance of World Enterprises for the year ending December 31, 2021, follows: Additional information: 1. There is $750 of supplies on hand on December 31, 2021. 2. The one-year...
Using the information in P11-2B, compute the overhead controllable variance and the overhead volume variance. Data From Problem 11-2B: Huang Company uses a standard cost accounting system to account...
Why does Cutco have a Forever Guarantee? Is this something that could cause difficulty for the firm?
Why does Vector Marketing, Cutco's direct marketing wing, typically employ college students?
How is that company different from a company that "becomes" global?
es Tech Solutions computes its predetermined overhead rate annually on the basis of direct labor-hours. At the beginning of the year, it estimated that 100,000 direct labor-hours would be required...
On June 30, Sharper Corporation's stockholders' equity section of its balance sheet appears as follows before any stock dividend or split. Sharper declares and immediately distributes a 50% stock...
Hubs Sprockets Direct Labor-Hours per Unit Annual Production 0.50 29,000 units 0.10 57,000 units Additional Information about the company follows: a. Hubs require $27 in direct materials per unit,...

How did Caterpillar use strategy as a real hedge to reduce its exposure to foreign exchange risk?

Question:

Step by Step Answer:

To reduce its economic exposure Caterpillar establis...View the full answer

International Business Competing in the Global Marketplace

Students also viewed these Business Communication questions