Why does promoter efficiency tend to decrease with the number of G C base pairs in

Question:

Why does promoter efficiency tend to decrease with the number of G ∙ C base pairs in the - 10 region of a prokaryotic gene?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals of biochemistry Life at the Molecular Level

ISBN: 978-0470547847

4th edition

Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt

See More Books

Question Posted: Apr 30, 2016 02:56 PM

See More Questions

Show the ideal Rankine cycle with three stages of reheating on a T-s diagram; assume the turbine inlet temperature is the same for all stages. How does the cycle efficiency vary with the number of...
Show the ideal Rankine cycle with three stages of reheating on a T-s diagram. Assume the turbine inlet temperature is the same for all stages. How does the cycle efficiency vary with the number of...
Does a power plant that has a higher thermal efficiency necessarily have a higher second-law efficiency than one with a lower thermal efficiency? Explain.
In Exercises 1-2, the augmented matrix of a linear system has been reduced by row operations to the form shown. In each case, continue the appropriate row operations and describe the solution set of...
On November 14, 2011, Noel sells 2,000 shares of Marker, Inc., stock for $6,000. He had purchased the stock two years earlier for $10,000. Because the price of the stock continued to drop, Noel...
On the moon, where a = 1.62m/sec2. An object dropped from a height of 100 m has distance above the ground of M(t) = 100 - a/2t2 where a is the acceleration of gravity. For each of the above planet...
Consider the inspection described in Example 2.11. From a bin of 50 parts, 6 parts are selected randomly without replacement. The bin contains 3 defective parts and 47 nondefective parts. What is the...
A truck with a cost of $82,000 has an estimated residual value of $16,000, has an estimated useful life of 12 years, and is depreciated by the straight-line method. (a) Determine the amount of the...
2. For the following three sets of electric field lines, what charge or charges would make such lines? Indicate their locations and type of charge (e.g. positive/negative) a.
Foster's considered that Southcorp's share price had traded above its fundamental value for a considerable period before the takeover offer, because it was expected to become a takeover target. The...
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
Explain why inserting 5 bp of DNA at the -50 position of a eukaryotic gene decreases the rate of RNA polymerase II transcription initiation to a greater extent than inserting 10 bp at the same site.
List the supported interfaces for programmatically interacting with OCI. A. Java, Python, Ruby, Go SDKs B. OCI CLI C. C++ SDK D. Terraform with the provider for OCI
Which of the following statements are TRUE? I. Equity investments that are held for trading are liable for zakat. II. Wages payable are not liable for zakat. III. Dividends received and receivable...
What is the distinction between an externally restricted fund and a board designated (internally restricted) fund?
How many IP addresses does a private load balancer require? A. One B. Two C. Three D. Four
What is other comprehensive income?
CharCo signs a contract to buy a special-order machine from a Swiss manufacturer. CharCo then hedges the commitment. How will the Canadian-dollar cost of the machine be determined?
A probability distribution can be written in formula notation such as P(X)= 1/X, where X = 2, 3, 6. The distribution is shown as follows: For Exercises write the distribution for the formula and...
Refrigerant R-12 at 30C, 0.75 MPa enters a steady flow device and exits at 30C, 100 kPa. Assume the process is isothermal and reversible. Find the change in availability of the refrigerant.
For an enzyme that displays MichaelisMenten kinetics, what is the reaction velocity, V (as a percentage of V max ), observed at the following values? (a) [S] = K M (b) [S] = 0.5K M (c) [S] = 0.1K M...
Determine the values of KM and Vmax for the de-carboxylation of a -keto acid given the following data. Substrate Concentration (mol L1) Velocity (mM min-1) 2.500.................. 0.588...
The kinetic data in the following table were obtained for the reaction of carbon dioxide and water to produce bicarbonate and hydrogen ion catalyzed by carbonic anhydrase: CO2 + H2O HCO-3 + H+ [H....
A 7 5 kg cliff - diver is falls from a height through the air head, diving towards the water. The drag coefficient for the diver is 0 . 8 3 and the area of the descending diver is 0 . 2 1 m ^ 2 ....
In the automobile industry, the dimensionless drag coefficient and the area of the vehicle are often combined into one variable - the drag area whereby the drag area is the product of the...
When you drop 10 pebbles into the well, you record the times for hearing the splash as 2.94 s, 3.11 s, 3.12 s, 2.97 s, 3.12 s, 2.97 s, 3.06 s, 3.21 s, 3.37 s, and 3.53 s. (a) Find the average time...

Why does promoter efficiency tend to decrease with the number of G C base pairs in

Question:

Step by Step Answer:

G C base pairs are more stable than A ...View the full answer

Fundamentals of biochemistry Life at the Molecular Level

Students also viewed these Medical Sciences questions