Write a JSF program that generates addition quizzes randomly, as shown in Figure 33.29a. After the user
Question:
Write a JSF program that generates addition quizzes randomly, as shown in Figure 33.29a. After the user answers all questions, it displays the result, as shown in Figure 33.29b.
Transcribed Image Text:
Exercise33_05 - Mozilla Firefox Fle Edit View History Bookmarks Tools Help OExercse33_05 e localhost:8080/chapter33jsfexercse/faces/Exercse33_05.xhtml ve 8- Google 20 + 3 - 23 17 + 3 = |20 16 + 5 = |21 14 + 7 = |21 22 +5 = 27 26+ 5 - 11 +1=5 21 +0 =5 14 +8 = 5 12 +2 =5 Submit Generate New Questions (a) O Addition Quiz - Mozilla Firefox le Cdit Vew listory Dookmarks Iools lep Adition Quiz bcahost:8080/chapter:33jsfexercserfaces/Exercise33_05.xhtr]| 8- Google 20 + 3 = 23 Correct 17+ 3 = 20 Correct 16 + 5 = 21 Corrct 14 +7 = 21 Correct 22 + 5 = 27 Correct 26 + 5 - 5 Wrong 11 +1=5 Wrong 21 + 0 = 5 Wrong 14 + 8 = 5 Wrong 12 +2 =5 Wrong There are 5 correct guesses (b)
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 85% (7 reviews)
Program Plan Create an xhtml file Exercise3305 which has the title Exercise3305 inside Program This program generate addition quiz and after user answers and submit solutions it displays the result xm...View the full answer
Answered By
Nazrin Ziad
I am a post graduate in Zoology with specialization in Entomology.I also have a Bachelor degree in Education.I posess more than 10 years of teaching as well as tutoring experience.I have done a project on histopathological analysis on alcohol treated liver of Albino Mice.
I can deal with every field under Biology from basic to advanced level.I can also guide you for your project works related to biological subjects other than tutoring.You can also seek my help for cracking competitive exams with biology as one of the subjects.
3.30+
2+ Reviews
10+ Question Solved
Related Book For
Introduction to Java Programming, Comprehensive Version
ISBN: 978-0133761313
10th Edition
Authors: Y. Daniel Liang
Question Posted:
Students also viewed these Computer science questions
-
Write a JSF page that displays a multiplication table as shown in Figure 33.26. O Display Multipication Table - Mozia Firefox Ele Edr yew Hgtory jookmarks Iook Hep Deply Mutpicatkon Tatle 3...
-
Write a JSF page that lets the user enter loan amount, interest rate, and number of years, as shown in Figure 33.28a. Click the Compute Loan Payment button to compute and display the monthly and...
-
Listing 4.3, GuessBirthday.java, gives a program for guessing a birthday. Write a JSF program that displays five sets of numbers, as shown in Figure 33.30a. After the user checks the appropriate...
-
Consider the function f(x) = sin(x). (a) Give the Taylor polynomial Ps(r) of degree 5 about a = /6 of this function. Note: use the exact values of sin(7/6)= 1/2 and cos(/6)= 3/2. (b) Give the nested...
-
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
-
Graph 2x 3y 6.
-
Parents of minors took Apple to court in 2012 for supplying game applications, on iPhones, that were free but through which users could purchase in-game currencies. Apparently, parents would log on...
-
Colonial State College is considering building a new multipurpose athletic complex on campus. The complex would provide a new gymnasium for intercollegiate basketball games, expanded office space,...
-
2. (24 Points) Find out the number of real roots of the cubic equation 23-6x+1=0. Justify your answer.
-
John Wallace is an automotive enthusiast. He has over 25 years of experience as a mechanic for the dealership of a large car manufacturer in Oakville. John also gained experience doing minor body...
-
Write a JSF page to let the user enter taxable income and filing status, as shown in Figure 33.27a. Clicking the Compute Tax button computes and displays the tax, as shown in Figure 33.27b. Use the...
-
Write a JSF program that views, inserts, and updates staff information stored in a database, as shown in Figure 33.32. The view button displays a record with a specified ID. The Staff table is...
-
In Exercises 9798, write the equation of each parabola in standard form. Vertex: (-3, -1); The graph passes through the point (-2, -3).
-
An unlevered firm has a value of $650 million. An otherwise identical but levered firm has $125 million in debt. Under the MM zero-tax model, what is the value of the levered firm?
-
Consider a model of random interest rates R; between year i and i+1. The R, are i.i.d. random variables such that 1+ R; is LogNormal (0.03,0.0010) distributed. Suppose you deposit an amount of 4000...
-
Find the present value of an annuity due that pays $1,600.00 at the beginning of each quarter for 4 years, if interest is earned at a rate of 4%, compounded quarterly.
-
What factors contribute to the predominant distribution of rainforests primarily encircling the equatorial regions of the Earth?
-
An executive is to receive a $1,500,000 signing bonus today, $2,500,000 one year from now, $2,750,000 two years from now, and $3,200,000 three years from now. Assuming an annual discount rate of 12%...
-
The condensed single-step income statement for the year ended December 31, 2014, of Conti Chemical Company, a distributor of farm fertilizers and herbicides, follows. Selected accounts from Conti...
-
Avatar Financials, Inc., located on Madison Avenue, New York City, is a company that provides financial advice to individuals and small- to mid-sized businesses. Its primary operations are in wealth...
-
Calculate the end-to-end transit time for a packet for both GEO (altitude: 35,800 km), MEO (altitude: 18,000 km) and LEO (altitude: 750 km) satellites.
-
What is the latency of a call originating at the North Pole to reach the South Pole if the call is routed via Iridium satellites? Assume that the switching time at the satellites is 10 microseconds...
-
What is the minimum bandwidth needed to achieve a data rate of B bits/sec if the signal is transmitted using NRZ, MLT-3, and Manchester encoding? Explain your answer.
-
The Nelson Company has $1,590,000 in current assets and $530,000 in current liabilities. Its initial inventory level is $390,000, and it will raise funds as additional notes payable and use them to...
-
The Smith's and the Jones are neighbors. They both have a tax rate of 28.5 mills. The Smith's house is assessed at $80,000. The Jones' house is assessed at $67,000. How much more do the Smith's pay...
-
Required information RWP7-1 (Algo) Great Adventures Continuing Case [The following information applies to the questions displayed below.] Tony and Suzie see the need for a rugged all-terrain vehicle...
Study smarter with the SolutionInn App