Question: 13. A serotonin molecule binds to a SHT2A receptor causing electrical impulses to be sent down a GABA neuron's axon terminal, eventually releasing GABA to

13. A serotonin molecule binds to a SHT2A receptor causing electrical impulses to be sent down a GABA neuron's axon terminal, eventually releasing GABA to the GABA-A receptor of its postsynaptic neuron. Which type of neurotransmission does this describe? OA Classic synaptic neurotransmission OB. Retrograde neurotransmission OC. Volume neurotransmission

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Accounting Questions!

HELP WITH THE FOLLOWING MULTIPLE-CHOICE PLEASE IMPORTANT: THIS IS FROM PREVIOUS EXAMS (not submitting, only practice) 6. Capacitors and batteries are similar because... A) Both can generate voltage....

thsts all we got NOTE: In a previous assignment you described the following "binding forces", and indicated their approximate strengths: Hydrogen bonding Ionic interactions Hydrophobic interactions...

14. Competitive inhibition occurs when a OA. molecule binds to an enzyme but doesn't change the shape of the active site. OB. molecule binds to an enzyme in the active site and prevents the substrate...

Match the term or concept with the best definition or description available A protein that serves both to link together a set of interacting proteins and to position them at a specific location in a...

competitive inhibition _ _ _ _ _ _ _ _ . an inhibitor molecule binds the enzyme at the active site. an inhibitor molecule binds the enzyme at a place other than the active site an inhibitor molecule...

Match each item with a description or definition. Integral membrane protein that binds a ligand to its exterior surface, A engendering a conformational change that gives rise to changes on the inside...

What do we call these "catalyst" molecules that speed up reactions inside living cells? (1 point) . Which macromolecule typically makes up these "catalysts"? (1 point) . What do we call the molecule...

2017 Chapter 20 Question 2- Multiple Choice Chapter 20 Question 2 - Multiple Choice Part A Which of the following is NOT a step in the enzyme-catalyzed conversion of a substrate to product? The...

Part 1 : one extended scenario with variations CRISPR Cas 9 was targeted to a particular sequence, \ ( 5 ^ { \ prime } \ ) - TAACCAGTGTTCCAAGGTGA - 3 ' ( PAM sequence shown in bold ) . 1 . During...

2 . Indicate whether the following statements are true or false. ( You do NOT need to explain your reasoning, but you can where you wish, and I will take such comments into consideration in the...

Calculate the R value for the fin-tube combination in Problem 2-116. Problem 2-116 An aluminum fin is attached to a transistor that generates heat at the rate of 300 mW. The fin has a total surface...

Let x 1 [n] be a sequence obtained by expanding the sequence x[n] = (1/4) n u[n] by a factor of 4; i.e., Find and sketch a six-point sequence q[n] whose six-point DFT Q[k] satisfies the two...

To help ensure an acceptable return rate in a questionnaire study, the researcher shouldGroup of answer choicesmake liberal use of open - ended questionsuse follow - up letters or e - mailsenclose or...

Discuss qualitative research designs in detail?