Question: A restriction enzyme cuts DNA at the base sequence: 5 G - AATTC 3 Will the piece of DNA below be cut by this enzyme?

A restriction enzyme cuts DNA at the base sequence:5 G-AATTC 3
Will the piece of DNA below be cut by this enzyme?
5TAGACTGAATTCAAGTCAAATAGAATTCCGATCCGAATTCGGG3
A restriction enzyme cuts DNA at the base sequence:5 G-AATTC 3
Will the piece of DNA below be cut by this enzyme?
5TAGACTGAATTCAAGTCAAATAGAATTCCGATCCGAATTCGGG3

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

The term 'endonuclease' refers to cutting the DNA sequence from ______________ a) only within the polynucleotide chain, not at the ends b) the ends of the chain c) anywhere in the chain d) exactly in...

Q:

Would the solution to 1.17 in Borodovsky and Ekisheva change if you had the following additional information? There are twice as many boxes with 6-base cutters as with 4-base cutters arranged in no...

Q:

Dr . S is obsessed with the movie Jurassic Park and has decided that she would like to clone a cryolophosaurus ( AKA Elvisaurus because it has a furrowed brow that looks like a pompadour ) . To do...

Q:

The restriction enzyme EcoRI is produced by the bacterium Escherichia coli strain R 1 3 . It has the restriction sequence as follows: 5 ' . . G ^ AATTC.. . 3 ' 3 ' . . CTTAA ^ G . . . 5 ' It will cut...

Q:

1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were used to create these sequences? b) Could the sequences below be hybridized and ligated? c) If it is...

Q:

Write down the known partial DNA sequence for the wild-type beta-globin gene as seen below. This sequence represents the portion of the beta-globin gene that has been amplified using PCR. Typically,...

Q:

1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were used to create these sequences? b) Could the sequences below be hybridized and ligated? c) If it is...

Q:

The following table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine,...

Q:

Scenario: You are studying a new genetic disease involving dysregulated inflammation and blood coagulation. You have determined that the patients suffering from this disease all share a mutation in...

Q:

Use the table to the right and the fragment of DNA below to identify the following: the palindromic sequence ( box it in ) the restriction endonuclease that cuts the DNA where the enzyme cuts the DNA...

Q:

If (a) (c) 1 -2] 5 3 2 3 3 6 2 4 -10 6 then A + AT equals 2 -4 (b) [1] 10 (d) None of these

Q:

Suppose that the random variable X has a lognormal distribution with parameter values = 1.2 and = 1.5. Find: (a) E(X) (b) Var(X) (c) The upper quartile of X (d) The lower quartile of X (e) The...

Q:

5. Which instruction disables hardware interrupts?

Q:

"The accounting standard setters have adopted what we call a mixed measurement model when it comes to measurement in accounting. With a recent trend towards measurement of items at fair value,...