Question: local sequence alignment with insertion/deletion length limit, by amending the Smith-Waterman algorithm which is attached below alphabet= {A, T, C, G} w (x, -)= -3

local sequence alignment with insertion/deletion length limit, by amending the Smith-Waterman algorithm which is attached below

alphabet= {A, T, C, G} w (x, -)= -3 (gap penalty) match score=5 mismatch=-2 The program should work for any two arbitrary strings. For example, S1=ACCTGATCATTTG' S2='AGCCATATCCTTAGACTGGTAC' Please modify it so that the local alignment (ignoring the unaligned ends of both sequences) that contains no more than d indels. (use d=4 in the program)

local sequence alignment with insertion/deletion length limit, by amending the Smith-Waterman

H(i,0) = 0, 0

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

C++ please, how would I implement two algorithms: i) Needleman-Wunsch algorithm for computing OPTIMAL GLOBAL ALIGNMENT, and ii) Smith-Waterman algorithm for computing OPTIMAL LOCAL ALIGNMENT, both...

e . Consider to be the Latin alphabet, comprising all 2 6 capital letters. v = BIOLGIA and w = AOILGAI, utilizing local sequence alignment consider the below proposed alignment ( with matches scored...

Here is the dynamic programming matrix resulting from a run of the standard pairwise local sequence alignment algorithm (with linear gap penalty d=8) on the protein sequences DWHAEP and WHEDPA, using...

e . Consider to be the Latin alphabet, comprising all 2 6 capital letters. Let v = BIOLGIA and w = AOILGAI, utilizing local sequence alignment consider the below proposed alignment ( with matches...

Using Java or C, C# Write a program that solves the Local Sequence Alignment problem using dynamic programming. (20 points) The input includes strings v, w and a scoring matrix ?. The output is an...

What is not true about the Smith - Waterman algorithm? Question 9 options: It is for local sequence alignment. The score of the best alignment is always on the lowest rightmost cell of the partial...

2. Using Biopython and the Smith-Waterman algorithm for local sequence alignment, print out the alignment of "TGAACTA" and "GGATCA". Use a match score of 1, mismatch score of -1, and gap score of -2....

please answer all for thumps up:) Match the BLOSUM scoring matrix best suited for alignments of sequences from each pair of organisms. BLOSUM40 1. Dog to Wolf BLOSUM90 2. Dog to Frog 3. Dog to Yeast...

This is in Pyton. Implement Local and Global sequence alignment that can also traceback, and develop webpage. Thanks! Online sequence alignment for siring matching to reference genomes. Create an...

1.15.12. . . 1...3. . 1. . 4 . . .1. . . 5 . . . 1 . . . 6 . . 1 . . . 7 . . . 1.Fill the following Matrix using the Needleman/Wunsch "Global" Dynamic Programming Sequence Alignment Method. Use Match...

A dairy researcher has developed a new technique for culturing cheese that is purported to age cheese in substantially less time than traditional methods without affecting other properties of the...

What is your reaction to the Fur Council of Canadas green advertising campaign? What would you say to an animal rights activist who is outraged at the claims the Fur Council is making?

Why might a taxpayer want to avoid having an exchange qualify as a like-kind exchange? . . . O A. A taxpayer may want to recognize a loss on the exchange to offset other gains. O B. A taxpayer may...

Question 2: Complete the MPS of the schedule given in the table below Jobs A23 BY4 A25 5C3 DD2 Processing times Due date (a) Schedule the jobs to a single machine in the order: A23, BY4, A25, SC3 and...

___ 17. Becoming a senior functional manager in my area of expertise is more attractive to me than becoming a general manager.

___ 21. I am most fulfilled in my career when I have been able to build something that is entirely the result of my own ideas and efforts.

___ 19. I will feel successful in my career only if I achieve complete autonomy and freedom.