PYTHON

Program Set 4(10 points extra credit) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, the program displays no gene is found. Allow the user to repeat the process as many times as the user wants until the user decides to quit. Here are the sample runs: >>> ========== RESTART: E:/HW3/HW3_4_genes.py ========== Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT TTT GGGCGT Enter a genome string: TGTGTGTATAT no gene is found >>> Test with 4 more genome strings. TGATGCTCTAAGGATGCGCCGTTGATT TGATGCTCTAGAGATGCGCCGTTGAATAT TGATGCGTCTAAGAGACTGCTCGCCGGTTGAATAT TGATGGCTCCTATGAGAATGGCGCCCGTTTCGAAATAT