In Python Programming:

812 (Bioinformatics: find genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and dis- plays all genes in the genome. If no gene is found in the input sequence, the pro- gram displays no gene is found. Here are the sample runs: Enter a genome string: TTATGTTTTAAGGATGGGGCGTTATT GGGCGT