Question: In Python Programming: (Bioinformatics: find genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a

In Python Programming: In Python Programming: (Bioinformatics: find genes) Biologists use a sequence of

(Bioinformatics: find genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and dis plays all genes in the genome. If no gene is found in the input sequence, the pro gram displays no gene is found. Here are the sample runs: 12 144 Enter a genome string: TTATGTTTTAAGGATCCCCTTAGTT GGGCGT

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Write a program for the following scenario with sample output(IN JAVA) Scenario: (Bioinformatics: finding genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a sub...

Need help with this code in C++ using only string functions and the simplest as possible As well as using namespace std; Biologists use a sequence of letters A, C, T, and G to model a genome. A gene...

Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the...

PYTHON Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA....

PYTHON Program Set 4(10 points extra credit) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a...

Can someone write a python program? Explain to me how the program work e appears 1 time in computer Program Set 4(10 points extra credit) Biologists use a sequence of letters A, C, T, and G to model...

Temple owns a video and photography business. He is a sole proprietor and uses his home as his place of business. His office meets the regular and exclusive use tests. Listed below are items that...

Which of the following statements regarding CPM is true? a. Some networks have nocritical path. b. The critical path isthat set of activities that has zero slack. c. All of the otherstatements are...

for a monthly interest rate of 2%, the effective annual rate is

should potenial employee consider an applicant,s social media during a job apllication

1. True or false. The law of diminishing marginal utility predicts the consumption behavior of addicts quite well. LO7.1

LO7.5 Give examples of several real-world phenomena that can be explained by applying the theory of consumer behavior.

5. Tammy spends her money on lemonade and iced tea. If the price of lemonade falls, it is as though her income . LO7.4 a. Increases. b. Decreases. c. Stays the same.