Question: Q4. Using the following Table below, do the following: 4.1) Draw a network diagram 4.2) Calculate Early Start (ES), Early Finish (EF), Late Start (LS)

Q4. Using the following Table below, do the following: 4.1) Draw a network diagram 4.2) Calculate Early Start (ES), Early Finish (EF), Late Start (LS) and Late Finish (LF) (Note: Clearly show step-by-step calculations to earn marks) 4.3) Identify Critical Path and its duration. (L02) (10 MARKS) Activity Description Immediate Duration Predecessor (weeks) Develop product specifications B Design manufacturing process Source & purchase materials D Source & purchase tooling & equipment Receive & install tooling & equipment Receive materials Pilot production run H Evaluate product design 1 Evaluate process performance G 3 Write documentation report H&I K Transition to manufacturing 2 (Note: Clearly show step-by-step calculations to earn marks) - None A A B D E&F G E F G 6 3 6 14 5 2 2 4 J

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related General Management Questions!

Develop a network diagram and compute Early Start ( ES ) , Early Finish ( EF ) , Late Start ( LS ) , Late Finish ( LF ) , Total Float ( TF ) , and Free Float ( FF ) for each activity. ( 2 . 4 points...

Q2 Draw a network diagram activity with Early Start (ES), Early Finish (EF), Late Start (LS), Late Finish (LF) based on information in Table Q2. Table Q2: Student Information System Tasks Activity...

A Teesside PLC has won a contract to work on a major Project to start on 1st November 2022. As a Project Manager you need to develop and analyse the planning schedule for this project using...

plesae 2 ) Calculate Early Start ( ES ) , Early Finish ( EF ) , Late Start ( LS ) , Late Finish ( LF ) and Total Float ( TF ) for each task. activity table is attached as a picture, please give...

1. Gaddar Roofs Inc is working on a project to install roofing in commercial offices. Johny Gaddar is concerned about project completion time due to the reliability of his workers. Below is a list of...

Oveiview You are assigned to a project team that is responsible for a Regional Financial Reporting Upgrade Project. This project will implement a new financial reporting application and process in...

Consider the following project network. The duration of each activity (in weeks) is listed below the activity in the network. For example, the duration of A is 5 weeks and that of Dis 8 weeks....

tual code de a Activity Predecessor Normal time A 2 B 3 C B A 5 G. F H 15 HH 2 D N M, J 1 - Calculate early start (ES), early finish (EF), late start (LS) and late finish (LF) for each activity -...

Draw a Gantt-Chart and CPM network for the project. Calculate early start (ES), early finish (EF), late start (LS), late finish (LF) and total float (TF) based on As Soon as Possible (ASAP) method...

Consider the project with the listed activities, and precedence relationships. Probabilistic durations are given (represented by Beta-distribution). Times are given in weeks. Expected Durations...

Consider the following cell array: c_array= {41, 'a'; 1:2:8, 'hai'} which of the following command produces output 7? (a) (b) (c) (d) c_array(3) (4) c_array(2, 1) (4) c_array{2} (4) both (b) and (c)

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...

Which of the following statements is not consistent with the GASB's "Budgeting Principle"? Multiple Choice Budgetary comparisons should be presented for the General Fund and each major special...

Read the articles on journaling and review the template provided. Identify what approach, to journaling, in the articles you found useful and why. Post to the discussion forum that you have reviewed...