Question: 4. View Animation 4.9 Polymerase Chain Reaction. a. The primers used for PCR are typically how many nucleotides long? b. In PCR, the machine


4. View Animation 4.9 Polymerase Chain Reaction. a. The primers used for PCR are typically how many nucleotides long? b. In PCR, the machine cycles between three different temperatures. What are the three temperatures and what happens at each temperature? c. How many copies of target DNA are theoretically generated from a single template after 25 cycles? d. The annealing temperature used in PCR is determined by the length and base pair composition of the oligonucleotide primer. A quick way to estimate the annealing temperature to use for an oligonucleotide is to add 4C for each G or C and 2C for each A or T in the oligonucleotide. What would be the annealing temperature if the sequence of the oligonucleotide primer was ATCTGAGTCATAGGTCAGAC?
Step by Step Solution
3.32 Rating (152 Votes )
There are 3 Steps involved in it
a The primers used for PCR are typically 2030 nucleotides long b In PCR the machine cycles between t... View full answer
Get step-by-step solutions from verified subject matter experts
